Rat NRP2(Neuropilin 2) ELISA Kit

Rat NRP2(Neuropilin 2) ELISA Kit

Human Neuropilin 2 (NRP2) ELISA Kit
RD-NRP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Neuropilin 2 (NRP2) ELISA Kit
RDR-NRP2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Neuropilin 2 (NRP2) ELISA Kit
RDR-NRP2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Rat Neuropilin 2 (NRP2) ELISA Kit
20-abx258953	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Neuropilin-2(NRP2) ELISA kit
CSB-EL016092RA-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropilin-2 (NRP2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Neuropilin-2(NRP2) ELISA kit
1-CSB-EL016092RA	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropilin-2(NRP2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Neuropilin 2 (NRP2) ELISA Kit
SED042Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropilin 2 (NRP2) ELISA Kit
SED042Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropilin 2 (NRP2) ELISA Kit
SED042Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropilin 2 (NRP2) ELISA Kit
SED042Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropilin 2 (NRP2) ELISA Kit
4-SED042Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Neuropilin 2 elisa. Alternative names of the recognized antigen: NP2 NPN2 VEGF165R2 VEGF165-R2 Vascular endothelial cell growth factor 165 receptor 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Neuropilin 2 (NRP2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat NRP2 (Neuropilin 2)
ELK7760	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuropilin 2 (NRP2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuropilin 2 ( Show more
Description: A sandwich ELISA kit for detection of Neuropilin 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Neuropilin 2 (NRP2) CLIA Kit
20-abx496525	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Neuropilin 2 (NRP2) Protein
20-abx068266	Abbexa	EUR 732.00 EUR 286.00 EUR 2263.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Nrp2 ELISA Kit| Rat Neuropilin-2 ELISA Kit
EF019062	Lifescience Market	96 Tests	EUR 689

Human Neuropilin 2 (NRP2) ELISA Kit
abx570530-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Mouse Neuropilin- 2, Nrp2 ELISA KIT
ELI-15030m	Lifescience Market	96 Tests	EUR 865

Human Neuropilin- 2, NRP2 ELISA KIT
ELI-46127h	Lifescience Market	96 Tests	EUR 824

Human Neuropilin 2 (NRP2) ELISA Kit
20-abx152507	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Neuropilin-2 (NRP2) ELISA Kit
abx390036-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Neuropilin-2(NRP2) ELISA kit
CSB-EL016092HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuropilin-2 (NRP2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neuropilin-2(NRP2) ELISA kit
1-CSB-EL016092HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuropilin-2(NRP2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Neuropilin 2 (NRP2) ELISA Kit
SED042Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 2 (NRP2) ELISA Kit
SED042Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 2 (NRP2) ELISA Kit
SED042Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 2 (NRP2) ELISA Kit
SED042Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 2 (NRP2) ELISA Kit
4-SED042Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Neuropilin 2 elisa. Alternative names of the recognized antigen: NP2 NPN2 VEGF165R2 VEGF165-R2 Vascular endothelial cell growth factor 165 receptor 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuropilin 2 (NRP2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Neuropilin 2 ELISA Kit (NRP2)
RK01964	Abclonal	96 Tests	EUR 521

Human Neuropilin 2(NRP2)ELISA Kit
QY-E01636	Qayee Biotechnology	96T	EUR 361

Neuropilin 2 (NRP2) Antibody
20-abx128984	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Neuropilin 2 (NRP2) Antibody
20-abx002017	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody
20-abx141040	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody
abx146242-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody
20-abx101013	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Neuropilin 2 (NRP2) Antibody
abx026336-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody
abx026336-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody
20-abx173800	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Neuropilin 2 (NRP2) Antibody
20-abx327622	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody
20-abx327864	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody
20-abx312973	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody
20-abx241693	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody
20-abx241694	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Neuropilin 2 (NRP2)
4-RPD042Hu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O60462 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.0kDa Isoelectric Point: 7.3
Description: Recombinant Human Neuropilin 2 expressed in: E.coli

Recombinant Neuropilin 2 (NRP2)
4-RPD042Ra01	Cloud-Clone	EUR 521.12 EUR 242.00 EUR 1679.20 EUR 626.40 EUR 1152.80 EUR 412.00 EUR 4048.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O35276 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 53.3kDa Isoelectric Point: 5.3
Description: Recombinant Rat Neuropilin 2 expressed in: E.coli

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat)
4-PAD042Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Glu652~Pro858) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2)

ELISA kit for Human NRP2 (Neuropilin 2)
E-EL-H1937	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's NRP2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human NRP2. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human NRP2 (Neuropilin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human NRP2 (Neuropilin 2)
ELK2886	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuropilin 2 (NRP2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuropilin 2 ( Show more
Description: A sandwich ELISA kit for detection of Neuropilin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Nrp2 ELISA Kit| Mouse Neuropilin-2 ELISA Kit
EF015675	Lifescience Market	96 Tests	EUR 689

Human Neuropilin 2 (NRP2) CLIA Kit
20-abx494061	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Neuropilin 2 (NRP2) Protein
20-abx166864	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Neuropilin 2 (NRP2) Antibody (HRP)
20-abx312974	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody (FITC)
20-abx312975	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody (Biotin)
20-abx312976	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody Pair
20-abx370696	Abbexa	EUR 1831.00 EUR 1163.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Neuropilin 2 (NRP2) Antibody (FITC)
20-abx271301	Abbexa	EUR 509.00 EUR 258.00 EUR 1525.00 EUR 704.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Neuropilin 2 (NRP2) Antibody (Biotin)
20-abx271567	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), APC
4-PAD042Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Glu652~Pro858) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with APC.

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), Biotinylated
4-PAD042Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Glu652~Pro858) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with Biotin.

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), Cy3
4-PAD042Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Glu652~Pro858) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with Cy3.

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), FITC
4-PAD042Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Glu652~Pro858) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with FITC.

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), HRP
4-PAD042Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Glu652~Pro858) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with HRP.

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), PE
4-PAD042Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Glu652~Pro858) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with PE.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human)
4-PAD042Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Gly231~Val490) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2)

Recombinant Human Neuropilin 2/NRP2 Protein
RP00225	Abclonal	10 μg	EUR 230

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), APC-Cy7
4-PAD042Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Glu652~Pro858) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with APC-Cy7.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), APC
4-PAD042Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Gly231~Val490) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with APC.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), Biotinylated
4-PAD042Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Gly231~Val490) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with Biotin.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), Cy3
4-PAD042Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Gly231~Val490) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with Cy3.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), FITC
4-PAD042Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Gly231~Val490) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with FITC.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), HRP
4-PAD042Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Gly231~Val490) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with HRP.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), PE
4-PAD042Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Gly231~Val490) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with PE.

Nrp2/ Rat Nrp2 ELISA Kit
ELI-36829r	Lifescience Market	96 Tests	EUR 886

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), APC-Cy7
4-PAD042Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NRP2 (Gly231~Val490) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with APC-Cy7.

ELISA kit for Rat Neuropilin-2
EK5615	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Neuropilin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Neuropilin-2 PicoKine ELISA Kit
EK1345	BosterBio	96 wells	EUR 425
Description: For quantitative detection of rat Neuropilin-2 in cell culture supernates and cell lysates.

Neuropilin-2 ELISA Kit (Rat) (OKBB00614)
OKBB00614	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: NRP2 (Neuropilin-2), also called Npn2 or VEGF165R2, encodes a member of the neuropilin family of receptor proteins. The soluble NRP2 was secreted as a 62.5-kD protein following transfection in Chinese hamster ovary cells. The NRP2 gene is mapped to 2q33.3. The NRP2 gene contains 17 exons and spans about 112 kb. This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Mice with null mutations in genes encoding Sema3F, and its holoreceptor components Npn2 and plexin A3 (PLEXA3), exhibit increased dentate gyrus granule cell and cortical layer V pyramidal neuron spine number and size, and also aberrant spine distribution. Moreover, Sema3F promotes loss of spines and excitatory synapses in dissociated neurons in vitro, and in NRP2-null brain slices cortical layer V and dentate gyrus granule cells exhibit increased miniature excitatory postsynaptic current frequency. These disparate effects of secreted semaphorins are reflected in the restricted dendritic localization of NRP2 to apical dendrites and of Npn1 to all dendrites of cortical pyramidal neurons.;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

NRP2 ELISA Kit (Rat) (OKCD08365)
OKCD08365	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: an axonal guidance molecule.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 29.2pg/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

ELISA kit for Mouse Neuropilin-2
EK5614	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Neuropilin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Neuropilin-2 PicoKine ELISA Kit
EK1344	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse Neuropilin-2 in cell culture supernates and cell lysates.

Neuropilin-2 ELISA Kit (Mouse) (OKBB00613)
OKBB00613	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: NRP2 (Neuropilin-2), also called Npn2 or VEGF165R2, encodes a member of the neuropilin family of receptor proteins. The soluble NRP2 was secreted as a 62.5-kD protein following transfection in Chinese hamster ovary cells. The NRP2 gene is mapped to 2q33.3. The NRP2 gene contains 17 exons and spans about 112 kb. This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Mice with null mutations in genes encoding Sema3F, and its holoreceptor components Npn2 and plexin A3 (PLEXA3), exhibit increased dentate gyrus granule cell and cortical layer V pyramidal neuron spine number and size, and also aberrant spine distribution. Moreover, Sema3F promotes loss of spines and excitatory synapses in dissociated neurons in vitro, and in NRP2-null brain slices cortical layer V and dentate gyrus granule cells exhibit increased miniature excitatory postsynaptic current frequency. These disparate effects of secreted semaphorins are reflected in the restricted dendritic localization of NRP2 to apical dendrites and of Npn1 to all dendrites of cortical pyramidal neurons.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

NRP2 ELISA KIT|Human
EF005348	Lifescience Market	96 Tests	EUR 689

Neuropilin- 2 Antibody
ABD7604	Lifescience Market	100 ug	EUR 438

Neuropilin-2 Antibody
DF7604	Affbiotech	200ul	EUR 304
Description: Neuropilin-2 Antibody detects endogenous levels of total Neuropilin-2.

Rat Neuropilin 1 (NRP1) ELISA Kit
abx570667-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Rat Neuropilin-1
EK5613	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Neuropilin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Neuropilin-1 PicoKine ELISA Kit
EK1343	BosterBio	96 wells	EUR 425
Description: For quantitative detection of rat Neuropilin-1 incell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Rat Neuropilin 1, NRP1 ELISA KIT
ELA-E1843r	Lifescience Market	96 Tests	EUR 886

Rat Neuropilin- 1, Nrp1 ELISA KIT
ELI-05928r	Lifescience Market	96 Tests	EUR 886

Rat Neuropilin 1 (NRP1) ELISA Kit
20-abx155886	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Neuropilin 1 (NRP1) ELISA Kit
DLR-NRP1-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neuropilin 1 (NRP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Neuropilin 1 (NRP1) ELISA Kit
DLR-NRP1-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neuropilin 1 (NRP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Neuropilin 1 (NRP1) ELISA Kit
SEA692Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4626.78
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 1 (NRP1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Neuropilin 1 (NRP1) ELISA Kit
SEA692Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 468.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 1 (NRP1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Neuropilin 1 (NRP1) ELISA Kit
SEA692Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 626.68
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 1 (NRP1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Neuropilin 1 (NRP1) ELISA Kit
SEA692Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2520.06
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 1 (NRP1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Neuropilin 1 (NRP1) ELISA Kit
4-SEA692Ra	Cloud-Clone	EUR 4677.00 EUR 2471.00 EUR 627.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Neuropilin 1 elisa. Alternative names of the recognized antigen: CD304 BDCA4 VEGF165R Vascular endothelial cell growth factor 165 receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Neuropilin 1 (NRP1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Neuropilin 1 (NRP1) ELISA Kit
RD-NRP1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Neuropilin 1 (NRP1) ELISA Kit
RD-NRP1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Neuropilin 1 (NRP1) ELISA Kit
RDR-NRP1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Neuropilin 1 (NRP1) ELISA Kit
RDR-NRP1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Rat Neuropilin 1(NRP1)ELISA kit
QY-E10213	Qayee Biotechnology	96T	EUR 361

Neuropilin-1 ELISA Kit (Rat) (OKBB00612)
OKBB00612	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: NRP1 (Neuropilin 1) also known as NP1, NRP, BDCA4 or VEGF165R, is a membrane-bound coreceptor to a tyrosine kinase receptor for both vascular endothelial growth factor (VEGF) and semaphorin family members. NRP1 plays versatile roles in angiogenesis, axon guidance, cell survival, migration, and invasion. By somatic cell hybrid analysis, the NRP1 gene was mapped to chromosome 10. NRP1 bounds PGF1 with lower affinity. NRP1-mediated interactions are a necessary element in the initiation of the primary immune response and offer another example, like that of agrin, of a molecule shared by neurologic and immunologic synapses. After T-cell contact with DC, T-cell NRP1 colocalized with CD3 in the immunologic synapse and, sometimes, also at the opposite pole of the T cell. Soluble NRP1 interacts in a homophilic fashion with NRP1 on both DC and T cells, and this binding can be inhibited by blocking antibodies to NRP1. Furthermore, selective NRP1 inhibition in this model suppressed neovascular formation substantially.;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 20 pg/mL

NRP2 ELISA Kit (Human) (OKCD01252)
OKCD01252	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: High affinity receptor for semaphorins 3C, 3F, VEGF-165 and VEGF-145 isoforms of VEGF, and the PLGF-2 isoform of PGF. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.32 ng/mL

NRP2 ELISA Kit (Human) (OKAN06109)
OKAN06109	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.33 ng/mL

NRP2 ELISA Kit (Human) (OKDD00438)
OKDD00438	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.073 ng/mL

NRP2 ELISA Kit (Human) (OKEH08347)
OKEH08347	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.15ng/mL

ELISA kit for Rat NRP1 (Neuropilin 1)
ELK3105	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuropilin 1 (NRP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuropilin 1 ( Show more
Description: A sandwich ELISA kit for detection of Neuropilin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Nrp2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6940003	ABM	1.0 ug DNA	EUR 154

Rat NRP2 shRNA Plasmid
20-abx986602	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Neuropilin-2 Polyclonal Antibody
ES7884-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Neuropilin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Neuropilin-2 Polyclonal Antibody
ES7884-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Neuropilin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Neuropilin-2 Polyclonal Antibody
ES3960-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Neuropilin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neuropilin-2 Polyclonal Antibody
ES3960-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Neuropilin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neuropilin 2 (NRP1) Antibody
20-abx121650	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Neuropilin-2 Polyclonal Antibody
ABP52961-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2 Applications tips:
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2

Neuropilin-2 Polyclonal Antibody
ABP52961-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2 Applications tips:
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2

Neuropilin-2 Polyclonal Antibody
ABP52961-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2 Applications tips:
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2

Neuropilin-2 Polyclonal Antibody
ABP56885-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2 Applications tips:
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2

Neuropilin-2 Polyclonal Antibody
ABP56885-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2 Applications tips:
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2

Neuropilin-2 Polyclonal Antibody
ABP56885-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2 Applications tips:
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2

Neuropilin 2 Blocking Peptide
20-abx162628	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Neuropilin 2 Blocking Peptide
20-abx061738	Abbexa	EUR 258.00 EUR 384.00	1 mg 5 mg
Shipped within 5-10 working days.

Neuropilin-2 Polyclonal Antibody
41638-100ul	SAB	100ul	EUR 252

Neuropilin-2 Polyclonal Antibody
41638-50ul	SAB	50ul	EUR 187

Neuropilin-2 Blocking Peptide
DF7604-BP	Affbiotech	1mg	EUR 195

Anti-Neuropilin-2 antibody
STJ94439	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Neuropilin-2.

Anti-Neuropilin-2 antibody
STJ96595	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Neuropilin-2.

Mouse neuropilin 1 ELISA kit
ELA-E1843m	Lifescience Market	96 Tests	EUR 865

Neuropilin-1 ELISA Kit| Mouse
EF012898	Lifescience Market	96 Tests	EUR 689

Mouse Neuropilin-1 ELISA Kit
EM0146	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P97333 Alias: Neuropilin-1/NRP1(Neuropilin 1)/BDCA-4/CD304/BDCA4/CD304 antigen/neuropilin 1/neuropilin-1/NRPNP1/transmembrane receptor/Vascular endothelial cell growth factor 165 receptor/VEGF165R
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

NRP2 siRNA
20-abx903662	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NRP2 siRNA
20-abx926418	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NRP2 siRNA
20-abx926419	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NRP2 Antibody
ABD7032	Lifescience Market	100 ug	EUR 438

NRP2 Antibody
32730-100ul	SAB	100ul	EUR 252

NRP2 Antibody
DF7032	Affbiotech	200ul	EUR 304
Description: NRP2 Antibody detects endogenous levels of total NRP2.

NRP2 Antibody
1-CSB-PA005175	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

NRP2 Antibody
1-CSB-PA563181	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NRP2 Antibody
1-CSB-PA255815	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NRP2 Antibody
1-CSB-PA070153	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

NRP2 Antibody
1-CSB-PA016092LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

anti-NRP2
YF-PA15893	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to NRP2

anti-NRP2
YF-PA25200	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to NRP2

Rat Neuropilin 1 (NRP1) CLIA Kit
20-abx491894	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Nrp2 ORF Vector (Rat) (pORF)
ORF071524	ABM	1.0 ug DNA	EUR 506

Neuropilin-2 Polyclonal Conjugated Antibody
C41638	SAB	100ul	EUR 397

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

Chicken Neuropilin 1 (NRP1) ELISA Kit
abx518590-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Neuropilin 1 (NRP1) ELISA Kit
abx360321-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Neuropilin 1 (NRP1) ELISA Kit
abx361065-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Neuropilin 1 (NRP1) ELISA Kit
abx363821-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Neuropilin 1 (NRP1) ELISA Kit
abx570645-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Neuropilin 1 (NRP1) ELISA Kit
abx572321-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

ELISA kit for Mouse Neuropilin-1
EK4012	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Neuropilin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Neuropilin-1
EK5621	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Neuropilin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Neuropilin-1 PicoKine ELISA Kit
EK1342	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse Neuropilin-1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Neuropilin-1 PicoKine ELISA Kit
EK1353	BosterBio	96 wells	EUR 455
Description: For quantitative detection of human Neuropilin-1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse Nrp1/ Neuropilin-1 ELISA Kit
E1058Mo	Sunlong	1 Kit	EUR 571

Human NRP1/ Neuropilin-1 ELISA Kit
E1795Hu	Sunlong	1 Kit	EUR 571

Human NRP1(Neuropilin-1) ELISA Kit
EH1959	FN Test	96T	EUR 524.1
Detection range: 78.125-5000 pg/ml Uniprot ID: O14786 Alias: NRP1(Neuropilin 1)/BDCA-4/CD304/BDCA4/CD304 antigen/neuropilin 1/neuropilin-1/NRPNP1/transmembrane receptor/Vascular endothelial cell growth factor 165 receptor/VEGF165R
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Mouse Neuropilin- 1, Nrp1 ELISA KIT
ELI-05926m	Lifescience Market	96 Tests	EUR 865

Chicken Neuropilin- 1, NRP1 ELISA KIT
ELI-05927c	Lifescience Market	96 Tests	EUR 928

Human Neuropilin- 1, NRP1 ELISA KIT
ELI-05929h	Lifescience Market	96 Tests	EUR 824

Mouse Neuropilin 1 (NRP1) ELISA Kit
20-abx154457	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Neuropilin 1 (NRP1) ELISA Kit
20-abx152506	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Chicken Neuropilin 1 (NRP1) ELISA Kit
abx356821-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Neuropilin 1 (NRP1) ELISA Kit
abx251281-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Mouse Neuropilin 1 (NRP1) ELISA Kit
abx254519-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human Neuropilin 1 (NRP1) ELISA Kit
DLR-NRP1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Neuropilin 1 (NRP1) ELISA Kit
DLR-NRP1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Neuropilin 1 (NRP1) ELISA Kit
DLR-NRP1-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Neuropilin 1 (NRP1) ELISA Kit
DLR-NRP1-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Neuropilin-1(NRP1) ELISA kit
CSB-EL016091HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuropilin-1 (NRP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neuropilin-1(NRP1) ELISA kit
1-CSB-EL016091HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuropilin-1(NRP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Neuropilin 1 (NRP1) ELISA Kit
SEA692Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 1 (NRP1) ELISA Kit
SEA692Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 1 (NRP1) ELISA Kit
SEA692Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 1 (NRP1) ELISA Kit
SEA692Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 1 (NRP1) ELISA Kit
4-SEA692Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Neuropilin 1 elisa. Alternative names of the recognized antigen: CD304 BDCA4 VEGF165R Vascular endothelial cell growth factor 165 receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Neuropilin 1 (NRP1) ELISA Kit
SEA692Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4391.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Neuropilin 1 (NRP1) ELISA Kit
SEA692Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 449.27
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Neuropilin 1 (NRP1) ELISA Kit
SEA692Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 598.96
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Neuropilin 1 (NRP1) ELISA Kit
SEA692Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2395.32
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Neuropilin 1 (NRP1) ELISA Kit
4-SEA692Mu	Cloud-Clone	EUR 4442.00 EUR 2346.00 EUR 599.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Neuropilin 1 elisa. Alternative names of the recognized antigen: CD304 BDCA4 VEGF165R Vascular endothelial cell growth factor 165 receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Neuropilin 1 ELISA Kit (NRP1)
RK03079	Abclonal	96 Tests	EUR 521

Human Neuropilin 1 (NRP1) ELISA Kit
RD-NRP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Neuropilin 1 (NRP1) ELISA Kit
RD-NRP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Neuropilin 1 (NRP1) ELISA Kit
RD-NRP1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Neuropilin 1 (NRP1) ELISA Kit
RD-NRP1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Human Neuropilin 1 (NRP1) ELISA Kit
RDR-NRP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Neuropilin 1 (NRP1) ELISA Kit
RDR-NRP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Neuropilin 1 (NRP1) ELISA Kit
RDR-NRP1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Neuropilin 1 (NRP1) ELISA Kit
RDR-NRP1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Human Neuropilin 1(NRP1)ELISA Kit
QY-E01637	Qayee Biotechnology	96T	EUR 361

Mouse Neuropilin 1(NRP1)ELISA kit
QY-E21079	Qayee Biotechnology	96T	EUR 361

Neuropilin-1 ELISA Kit (Mouse) (OKBB00611)
OKBB00611	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: NRP1 (Neuropilin 1) also known as NP1, NRP, BDCA4 or VEGF165R, is a membrane-bound coreceptor to a tyrosine kinase receptor for both vascular endothelial growth factor (VEGF) and semaphorin family members. NRP1 plays versatile roles in angiogenesis, axon guidance, cell survival, migration, and invasion. By somatic cell hybrid analysis, the NRP1 gene was mapped to chromosome 10. NRP1 bounds PGF1 with lower affinity. NRP1-mediated interactions are a necessary element in the initiation of the primary immune response and offer another example, like that of agrin, of a molecule shared by neurologic and immunologic synapses. After T-cell contact with DC, T-cell NRP1 colocalized with CD3 in the immunologic synapse and, sometimes, also at the opposite pole of the T cell. Soluble NRP1 interacts in a homophilic fashion with NRP1 on both DC and T cells, and this binding can be inhibited by blocking antibodies to NRP1. Furthermore, selective NRP1 inhibition in this model suppressed neovascular formation substantially.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 20 pg/mL

Neuropilin-1 ELISA Kit (Human) (OKBB00667)
OKBB00667	Aviva Systems Biology	96 Wells	EUR 544
Description: Description of target: NRP1 (Neuropilin 1) also known as NP1, NRP, BDCA4 or VEGF165R, is a membrane-bound coreceptor to a tyrosine kinase receptor for both vascular endothelial growth factor (VEGF) and semaphorin family members. NRP1 plays versatile roles in angiogenesis, axon guidance, cell survival, migration, and invasion. By somatic cell hybrid analysis, the NRP1 gene was mapped to chromosome 10. NRP1 bounds PGF1 with lower affinity. NRP1-mediated interactions are a necessary element in the initiation of the primary immune response and offer another example, like that of agrin, of a molecule shared by neurologic and immunologic synapses. After T-cell contact with DC, T-cell NRP1 colocalized with CD3 in the immunologic synapse and, sometimes, also at the opposite pole of the T cell. Soluble NRP1 interacts in a homophilic fashion with NRP1 on both DC and T cells, and this binding can be inhibited by blocking antibodies to NRP1. Furthermore, selective NRP1 inhibition in this model suppressed neovascular formation substantially.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 20 pg/mL

Neuropilin antibody
70R-7286	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Neuropilin antibody raised against the N terminal of NETO2

Neuropilin antibody
70R-7424	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Neuropilin antibody raised against the N terminal of NETO2

Neuropilin antibody
10R-10590	Fitzgerald	100 ug	EUR 349
Description: Mouse monoclonal Neuropilin antibody

NRP2 Conjugated Antibody
C32730	SAB	100ul	EUR 397

NRP2 cloning plasmid
CSB-CL016092HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 300 Sequence: atggatatgtttcctctcacctgggttttcttagccctctacttttcaagacaccaagtgagaggccaaccagacccaccgtgcggaggtcgtttgaattccaaagatgctggctatatcacctctcccggttacccccaggactacccctcccaccagaactgcgagtggattgt Show more
Description: A cloning plasmid for the NRP2 gene.

NRP2 cloning plasmid
CSB-CL016092HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2781 Sequence: atggatatgtttcctctcacctgggttttcttagccctctacttttcaagacaccaagtgagaggccaaccagacccaccgtgcggaggtcgtttgaattccaaagatgctggctatatcacctctcccggttacccccaggactacccctcccaccagaactgcgagtggattg Show more
Description: A cloning plasmid for the NRP2 gene.

NRP2 Rabbit pAb
A12758-100ul	Abclonal	100 ul	EUR 308

NRP2 Rabbit pAb
A12758-200ul	Abclonal	200 ul	EUR 459

NRP2 Rabbit pAb
A12758-20ul	Abclonal	20 ul	EUR 183

NRP2 Rabbit pAb
A12758-50ul	Abclonal	50 ul	EUR 223

NRP2 Rabbit pAb
A2581-100ul	Abclonal	100 ul	EUR 308

NRP2 Rabbit pAb
A2581-200ul	Abclonal	200 ul	EUR 459

NRP2 Rabbit pAb
A2581-20ul	Abclonal	20 ul	EUR 183

NRP2 Rabbit pAb
A2581-50ul	Abclonal	50 ul	EUR 223

NRP2 Blocking Peptide
DF7032-BP	Affbiotech	1mg	EUR 195

Anti-NRP2 Antibody
PA1771	BosterBio	100ug/vial	EUR 294

Anti-NRP2 antibody
STJ24823	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene.

Anti-NRP2 antibody
STJ114631	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene.

Anti-NRP2 (3B8)
YF-MA16541	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to NRP2

Human Neuropilin and tolloid- like protein 2, NETO2 ELISA KIT
ELI-16459h	Lifescience Market	96 Tests	EUR 824

Mouse Neuropilin and tolloid- like protein 2, Neto2 ELISA KIT
ELI-44722m	Lifescience Market	96 Tests	EUR 865

Rat NRP2(Neuropilin 2) ELISA Kit