Rat NRP2(Neuropilin 2) ELISA Kit
Human Neuropilin 2 (NRP2) ELISA Kit |
RD-NRP2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Neuropilin 2 (NRP2) ELISA Kit |
RDR-NRP2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Neuropilin 2 (NRP2) ELISA Kit |
RDR-NRP2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Neuropilin 2 (NRP2) ELISA Kit |
20-abx258953 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Neuropilin-2(NRP2) ELISA kit |
CSB-EL016092RA-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropilin-2 (NRP2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rat Neuropilin-2(NRP2) ELISA kit |
1-CSB-EL016092RA |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropilin-2(NRP2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Neuropilin 2 (NRP2) ELISA Kit |
SED042Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neuropilin 2 (NRP2) ELISA Kit |
SED042Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neuropilin 2 (NRP2) ELISA Kit |
SED042Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neuropilin 2 (NRP2) ELISA Kit |
SED042Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Neuropilin 2 (NRP2) ELISA Kit |
4-SED042Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neuropilin 2 elisa. Alternative names of the recognized antigen: NP2
- NPN2
- VEGF165R2
- VEGF165-R2
- Vascular endothelial cell growth factor 165 receptor 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Neuropilin 2 (NRP2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
ELISA kit for Rat NRP2 (Neuropilin 2) |
ELK7760 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuropilin 2 (NRP2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuropilin 2 (
- Show more
|
Description: A sandwich ELISA kit for detection of Neuropilin 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rat Neuropilin 2 (NRP2) CLIA Kit |
20-abx496525 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Neuropilin 2 (NRP2) Protein |
20-abx068266 |
Abbexa |
-
EUR 732.00
-
EUR 286.00
-
EUR 2263.00
-
EUR 871.00
-
EUR 523.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Neuropilin 2 (NRP2) ELISA Kit |
abx570530-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Human Neuropilin 2 (NRP2) ELISA Kit |
20-abx152507 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Neuropilin-2 (NRP2) ELISA Kit |
abx390036-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Neuropilin-2(NRP2) ELISA kit |
CSB-EL016092HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Neuropilin-2 (NRP2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Neuropilin-2(NRP2) ELISA kit |
1-CSB-EL016092HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Neuropilin-2(NRP2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Neuropilin 2 (NRP2) ELISA Kit |
SED042Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Neuropilin 2 (NRP2) ELISA Kit |
SED042Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Neuropilin 2 (NRP2) ELISA Kit |
SED042Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Neuropilin 2 (NRP2) ELISA Kit |
SED042Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates and other biological fluids. |
Human Neuropilin 2 (NRP2) ELISA Kit |
4-SED042Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neuropilin 2 elisa. Alternative names of the recognized antigen: NP2
- NPN2
- VEGF165R2
- VEGF165-R2
- Vascular endothelial cell growth factor 165 receptor 2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuropilin 2 (NRP2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Neuropilin 2 ELISA Kit (NRP2) |
RK01964 |
Abclonal |
96 Tests |
EUR 521 |
Neuropilin 2 (NRP2) Antibody |
20-abx128984 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neuropilin 2 (NRP2) Antibody |
20-abx002017 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Neuropilin 2 (NRP2) Antibody |
20-abx141040 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Neuropilin 2 (NRP2) Antibody |
abx146242-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Neuropilin 2 (NRP2) Antibody |
20-abx101013 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neuropilin 2 (NRP2) Antibody |
abx026336-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Neuropilin 2 (NRP2) Antibody |
abx026336-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Neuropilin 2 (NRP2) Antibody |
20-abx173800 |
Abbexa |
|
|
|
Neuropilin 2 (NRP2) Antibody |
20-abx327622 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuropilin 2 (NRP2) Antibody |
20-abx327864 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuropilin 2 (NRP2) Antibody |
20-abx312973 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuropilin 2 (NRP2) Antibody |
20-abx241693 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuropilin 2 (NRP2) Antibody |
20-abx241694 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Neuropilin 2 (NRP2) |
4-RPD042Hu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O60462
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 33.0kDa
- Isoelectric Point: 7.3
|
Description: Recombinant Human Neuropilin 2 expressed in: E.coli |
Recombinant Neuropilin 2 (NRP2) |
4-RPD042Ra01 |
Cloud-Clone |
-
EUR 521.12
-
EUR 242.00
-
EUR 1679.20
-
EUR 626.40
-
EUR 1152.80
-
EUR 412.00
-
EUR 4048.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O35276
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 53.3kDa
- Isoelectric Point: 5.3
|
Description: Recombinant Rat Neuropilin 2 expressed in: E.coli |
Neuropilin 2 (NRP2) Polyclonal Antibody (Rat) |
4-PAD042Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Glu652~Pro858)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2) |
ELISA kit for Human NRP2 (Neuropilin 2) |
E-EL-H1937 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's NRP2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human NRP2. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human NRP2 (Neuropilin 2) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human NRP2 (Neuropilin 2) |
ELK2886 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuropilin 2 (NRP2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuropilin 2 (
- Show more
|
Description: A sandwich ELISA kit for detection of Neuropilin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Neuropilin 2 (NRP2) CLIA Kit |
20-abx494061 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Neuropilin 2 (NRP2) Protein |
20-abx166864 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neuropilin 2 (NRP2) Antibody (HRP) |
20-abx312974 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuropilin 2 (NRP2) Antibody (FITC) |
20-abx312975 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuropilin 2 (NRP2) Antibody (Biotin) |
20-abx312976 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuropilin 2 (NRP2) Antibody Pair |
20-abx370696 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Neuropilin 2 (NRP2) Antibody (FITC) |
20-abx271301 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1525.00
-
EUR 704.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Neuropilin 2 (NRP2) Antibody (Biotin) |
20-abx271567 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), APC |
4-PAD042Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Glu652~Pro858)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with APC. |
Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), Biotinylated |
4-PAD042Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Glu652~Pro858)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with Biotin. |
Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), Cy3 |
4-PAD042Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Glu652~Pro858)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with Cy3. |
Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), FITC |
4-PAD042Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Glu652~Pro858)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with FITC. |
Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), HRP |
4-PAD042Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Glu652~Pro858)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with HRP. |
Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), PE |
4-PAD042Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Glu652~Pro858)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with PE. |
Neuropilin 2 (NRP2) Polyclonal Antibody (Human) |
4-PAD042Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Gly231~Val490)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2) |
Recombinant Human Neuropilin 2/NRP2 Protein |
RP00225 |
Abclonal |
10 μg |
EUR 230 |
Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAD042Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Glu652~Pro858)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with APC-Cy7. |
Neuropilin 2 (NRP2) Polyclonal Antibody (Human), APC |
4-PAD042Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Gly231~Val490)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with APC. |
Neuropilin 2 (NRP2) Polyclonal Antibody (Human), Biotinylated |
4-PAD042Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Gly231~Val490)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with Biotin. |
Neuropilin 2 (NRP2) Polyclonal Antibody (Human), Cy3 |
4-PAD042Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Gly231~Val490)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with Cy3. |
Neuropilin 2 (NRP2) Polyclonal Antibody (Human), FITC |
4-PAD042Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Gly231~Val490)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with FITC. |
Neuropilin 2 (NRP2) Polyclonal Antibody (Human), HRP |
4-PAD042Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Gly231~Val490)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with HRP. |
Neuropilin 2 (NRP2) Polyclonal Antibody (Human), PE |
4-PAD042Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Gly231~Val490)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with PE. |
Neuropilin 2 (NRP2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD042Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRP2 (Gly231~Val490)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with APC-Cy7. |
ELISA kit for Rat Neuropilin-2 |
EK5615 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Neuropilin-2 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Rat Neuropilin-2 PicoKine ELISA Kit |
EK1345 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of rat Neuropilin-2 in cell culture supernates and cell lysates. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
ELISA kit for Mouse Neuropilin-2 |
EK5614 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Neuropilin-2 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse Neuropilin-2 PicoKine ELISA Kit |
EK1344 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse Neuropilin-2 in cell culture supernates and cell lysates. |
Rat Neuropilin 1 (NRP1) ELISA Kit |
abx570667-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
ELISA kit for Rat Neuropilin-1 |
EK5613 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Neuropilin-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Rat Neuropilin-1 PicoKine ELISA Kit |
EK1343 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of rat Neuropilin-1 incell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
Rat Neuropilin 1 (NRP1) ELISA Kit |
20-abx155886 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Neuropilin 1 (NRP1) ELISA Kit |
DLR-NRP1-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neuropilin 1 (NRP1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Neuropilin 1 (NRP1) ELISA Kit |
DLR-NRP1-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neuropilin 1 (NRP1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Neuropilin 1 (NRP1) ELISA Kit |
SEA692Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4626.78 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 1 (NRP1) in Tissue homogenates, cell lysates and other biological fluids. |
Rat Neuropilin 1 (NRP1) ELISA Kit |
SEA692Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 468.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 1 (NRP1) in Tissue homogenates, cell lysates and other biological fluids. |
Rat Neuropilin 1 (NRP1) ELISA Kit |
SEA692Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 626.68 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 1 (NRP1) in Tissue homogenates, cell lysates and other biological fluids. |
Rat Neuropilin 1 (NRP1) ELISA Kit |
SEA692Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2520.06 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 1 (NRP1) in Tissue homogenates, cell lysates and other biological fluids. |
Rat Neuropilin 1 (NRP1) ELISA Kit |
4-SEA692Ra |
Cloud-Clone |
-
EUR 4677.00
-
EUR 2471.00
-
EUR 627.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neuropilin 1 elisa. Alternative names of the recognized antigen: CD304
- BDCA4
- VEGF165R
- Vascular endothelial cell growth factor 165 receptor
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Neuropilin 1 (NRP1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Neuropilin 1 (NRP1) ELISA Kit |
RD-NRP1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Neuropilin 1 (NRP1) ELISA Kit |
RD-NRP1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Neuropilin 1 (NRP1) ELISA Kit |
RDR-NRP1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Neuropilin 1 (NRP1) ELISA Kit |
RDR-NRP1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Neuropilin-2 Antibody |
DF7604 |
Affbiotech |
200ul |
EUR 304 |
Description: Neuropilin-2 Antibody detects endogenous levels of total Neuropilin-2. |
ELISA kit for Rat NRP1 (Neuropilin 1) |
ELK3105 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuropilin 1 (NRP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuropilin 1 (
- Show more
|
Description: A sandwich ELISA kit for detection of Neuropilin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Nrp2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6940003 |
ABM |
1.0 ug DNA |
EUR 154 |
Rat NRP2 shRNA Plasmid |
20-abx986602 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Neuropilin-2 Polyclonal Antibody |
ES7884-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Neuropilin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Neuropilin-2 Polyclonal Antibody |
ES7884-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Neuropilin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Neuropilin-2 Polyclonal Antibody |
ES3960-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Neuropilin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Neuropilin-2 Polyclonal Antibody |
ES3960-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Neuropilin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Neuropilin 2 (NRP1) Antibody |
20-abx121650 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Neuropilin-2 Polyclonal Antibody |
ABP52961-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2
- Applications tips:
|
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2 |
Neuropilin-2 Polyclonal Antibody |
ABP52961-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2
- Applications tips:
|
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2 |
Neuropilin-2 Polyclonal Antibody |
ABP52961-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2
- Applications tips:
|
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2 |
Neuropilin-2 Polyclonal Antibody |
ABP56885-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2
- Applications tips:
|
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2 |
Neuropilin-2 Polyclonal Antibody |
ABP56885-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2
- Applications tips:
|
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2 |
Neuropilin-2 Polyclonal Antibody |
ABP56885-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2
- Applications tips:
|
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2 |
Neuropilin 2 Blocking Peptide |
20-abx162628 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuropilin 2 Blocking Peptide |
20-abx061738 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuropilin-2 Polyclonal Antibody |
41638-100ul |
SAB |
100ul |
EUR 252 |
Neuropilin-2 Polyclonal Antibody |
41638-50ul |
SAB |
50ul |
EUR 187 |
Neuropilin-2 Blocking Peptide |
DF7604-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-Neuropilin-2 antibody |
STJ94439 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Neuropilin-2. |
Anti-Neuropilin-2 antibody |
STJ96595 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Neuropilin-2. |
Mouse Neuropilin-1 ELISA Kit |
EM0146 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P97333
- Alias: Neuropilin-1/NRP1(Neuropilin 1)/BDCA-4/CD304/BDCA4/CD304 antigen/neuropilin 1/neuropilin-1/NRPNP1/transmembrane receptor/Vascular endothelial cell growth factor 165 receptor/VEGF165R
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml |
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
NRP2 siRNA |
20-abx903662 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NRP2 siRNA |
20-abx926418 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NRP2 siRNA |
20-abx926419 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NRP2 Antibody |
32730-100ul |
SAB |
100ul |
EUR 252 |
NRP2 Antibody |
DF7032 |
Affbiotech |
200ul |
EUR 304 |
Description: NRP2 Antibody detects endogenous levels of total NRP2. |
NRP2 Antibody |
1-CSB-PA005175 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
NRP2 Antibody |
1-CSB-PA563181 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
NRP2 Antibody |
1-CSB-PA255815 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
NRP2 Antibody |
1-CSB-PA070153 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000 |
NRP2 Antibody |
1-CSB-PA016092LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
anti-NRP2 |
YF-PA15893 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to NRP2 |
anti-NRP2 |
YF-PA25200 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to NRP2 |
Rat Neuropilin 1 (NRP1) CLIA Kit |
20-abx491894 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Nrp2 ORF Vector (Rat) (pORF) |
ORF071524 |
ABM |
1.0 ug DNA |
EUR 506 |
Chicken Neuropilin 1 (NRP1) ELISA Kit |
abx518590-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Neuropilin 1 (NRP1) ELISA Kit |
abx360321-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Neuropilin 1 (NRP1) ELISA Kit |
abx361065-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Neuropilin 1 (NRP1) ELISA Kit |
abx363821-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Mouse Neuropilin 1 (NRP1) ELISA Kit |
abx570645-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Neuropilin 1 (NRP1) ELISA Kit |
abx572321-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse Neuropilin-1 |
EK4012 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Neuropilin-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
ELISA kit for Human Neuropilin-1 |
EK5621 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Neuropilin-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse Neuropilin-1 PicoKine ELISA Kit |
EK1342 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse Neuropilin-1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
Human Neuropilin-1 PicoKine ELISA Kit |
EK1353 |
BosterBio |
96 wells |
EUR 455 |
Description: For quantitative detection of human Neuropilin-1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
Mouse Nrp1/ Neuropilin-1 ELISA Kit |
E1058Mo |
Sunlong |
1 Kit |
EUR 571 |
Human NRP1/ Neuropilin-1 ELISA Kit |
E1795Hu |
Sunlong |
1 Kit |
EUR 571 |
Human NRP1(Neuropilin-1) ELISA Kit |
EH1959 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 78.125-5000 pg/ml
- Uniprot ID: O14786
- Alias: NRP1(Neuropilin 1)/BDCA-4/CD304/BDCA4/CD304 antigen/neuropilin 1/neuropilin-1/NRPNP1/transmembrane receptor/Vascular endothelial cell growth factor 165 receptor/VEGF165R
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml |
Mouse Neuropilin 1 (NRP1) ELISA Kit |
20-abx154457 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Neuropilin 1 (NRP1) ELISA Kit |
20-abx152506 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Chicken Neuropilin 1 (NRP1) ELISA Kit |
abx356821-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Neuropilin 1 (NRP1) ELISA Kit |
abx251281-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Mouse Neuropilin 1 (NRP1) ELISA Kit |
abx254519-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human Neuropilin 1 (NRP1) ELISA Kit |
DLR-NRP1-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Neuropilin 1 (NRP1) ELISA Kit |
DLR-NRP1-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Neuropilin 1 (NRP1) ELISA Kit |
DLR-NRP1-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Neuropilin 1 (NRP1) ELISA Kit |
DLR-NRP1-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Neuropilin-1(NRP1) ELISA kit |
CSB-EL016091HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Neuropilin-1 (NRP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Neuropilin-1(NRP1) ELISA kit |
1-CSB-EL016091HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Neuropilin-1(NRP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Neuropilin 1 (NRP1) ELISA Kit |
SEA692Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Neuropilin 1 (NRP1) ELISA Kit |
SEA692Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Neuropilin 1 (NRP1) ELISA Kit |
SEA692Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Neuropilin 1 (NRP1) ELISA Kit |
SEA692Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Neuropilin 1 (NRP1) ELISA Kit |
4-SEA692Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neuropilin 1 elisa. Alternative names of the recognized antigen: CD304
- BDCA4
- VEGF165R
- Vascular endothelial cell growth factor 165 receptor
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Neuropilin 1 (NRP1) ELISA Kit |
SEA692Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Neuropilin 1 (NRP1) ELISA Kit |
SEA692Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Neuropilin 1 (NRP1) ELISA Kit |
SEA692Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Neuropilin 1 (NRP1) ELISA Kit |
SEA692Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Neuropilin 1 (NRP1) ELISA Kit |
4-SEA692Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neuropilin 1 elisa. Alternative names of the recognized antigen: CD304
- BDCA4
- VEGF165R
- Vascular endothelial cell growth factor 165 receptor
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Neuropilin 1 ELISA Kit (NRP1) |
RK03079 |
Abclonal |
96 Tests |
EUR 521 |
Human Neuropilin 1 (NRP1) ELISA Kit |
RD-NRP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Neuropilin 1 (NRP1) ELISA Kit |
RD-NRP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Neuropilin 1 (NRP1) ELISA Kit |
RD-NRP1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Neuropilin 1 (NRP1) ELISA Kit |
RD-NRP1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Human Neuropilin 1 (NRP1) ELISA Kit |
RDR-NRP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Neuropilin 1 (NRP1) ELISA Kit |
RDR-NRP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Neuropilin 1 (NRP1) ELISA Kit |
RDR-NRP1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Neuropilin 1 (NRP1) ELISA Kit |
RDR-NRP1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Neuropilin-2 Polyclonal Conjugated Antibody |
C41638 |
SAB |
100ul |
EUR 397 |
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol) |
RAT-5 |
Alpha Diagnostics |
1 |
EUR 1138 |
Neuropilin antibody |
70R-7286 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Neuropilin antibody raised against the N terminal of NETO2 |
Neuropilin antibody |
70R-7424 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal Neuropilin antibody raised against the N terminal of NETO2 |
Neuropilin antibody |
10R-10590 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Mouse monoclonal Neuropilin antibody |
NRP2 Conjugated Antibody |
C32730 |
SAB |
100ul |
EUR 397 |
NRP2 cloning plasmid |
CSB-CL016092HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 300
- Sequence: atggatatgtttcctctcacctgggttttcttagccctctacttttcaagacaccaagtgagaggccaaccagacccaccgtgcggaggtcgtttgaattccaaagatgctggctatatcacctctcccggttacccccaggactacccctcccaccagaactgcgagtggattgt
- Show more
|
Description: A cloning plasmid for the NRP2 gene. |
NRP2 cloning plasmid |
CSB-CL016092HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2781
- Sequence: atggatatgtttcctctcacctgggttttcttagccctctacttttcaagacaccaagtgagaggccaaccagacccaccgtgcggaggtcgtttgaattccaaagatgctggctatatcacctctcccggttacccccaggactacccctcccaccagaactgcgagtggattg
- Show more
|
Description: A cloning plasmid for the NRP2 gene. |
NRP2 Rabbit pAb |
A12758-100ul |
Abclonal |
100 ul |
EUR 308 |
NRP2 Rabbit pAb |
A12758-200ul |
Abclonal |
200 ul |
EUR 459 |
NRP2 Rabbit pAb |
A12758-20ul |
Abclonal |
20 ul |
EUR 183 |
NRP2 Rabbit pAb |
A12758-50ul |
Abclonal |
50 ul |
EUR 223 |
NRP2 Rabbit pAb |
A2581-100ul |
Abclonal |
100 ul |
EUR 308 |
NRP2 Rabbit pAb |
A2581-200ul |
Abclonal |
200 ul |
EUR 459 |
NRP2 Rabbit pAb |
A2581-20ul |
Abclonal |
20 ul |
EUR 183 |
NRP2 Rabbit pAb |
A2581-50ul |
Abclonal |
50 ul |
EUR 223 |
NRP2 Blocking Peptide |
DF7032-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-NRP2 Antibody |
PA1771 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-NRP2 antibody |
STJ24823 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. |
Anti-NRP2 antibody |
STJ114631 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. |
Anti-NRP2 (3B8) |
YF-MA16541 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NRP2 |
Human Neuropilin and tolloid- like protein 2, NETO2 ELISA KIT |
ELI-16459h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Neuropilin and tolloid- like protein 2, Neto2 ELISA KIT |
ELI-44722m |
Lifescience Market |
96 Tests |
EUR 865 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Rat Neuropilin 1 (NRP1) Protein |
20-abx068258 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat Neuropilin 1 (NRP1) Protein |
20-abx068260 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat Neuropilin 1 (NRP1) Protein |
20-abx068261 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Rat Neuropilin 1 (NRP1) Protein |
20-abx068265 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Nrp2 sgRNA CRISPR Lentivector set (Rat) |
K6940001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
ELISA kit for Human NRP1 (Neuropilin 1) |
ELK2885 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuropilin 1 (NRP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuropilin 1 (
- Show more
|
Description: A sandwich ELISA kit for detection of Neuropilin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse NRP1 (Neuropilin 1) |
ELK3076 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuropilin 1 (NRP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuropilin 1 (
- Show more
|
Description: A sandwich ELISA kit for detection of Neuropilin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human NRP1 (Neuropilin 1) |
E-EL-H1247 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's NRP1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human NRP1. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human NRP1 (Neuropilin 1) in samples from Serum, Plasma, Cell supernatant |
Rat NRP2(Neuropilin 2) ELISA Kit