Rat NRP2(Neuropilin 2) ELISA Kit

Rat NRP2(Neuropilin 2) ELISA Kit

Human Neuropilin 2 (NRP2) ELISA Kit

RDR-NRP2-Hu-96Tests 96 Tests
EUR 756

Human Neuropilin 2 (NRP2) ELISA Kit

RD-NRP2-Hu-48Tests 48 Tests
EUR 521

Human Neuropilin 2 (NRP2) ELISA Kit

RD-NRP2-Hu-96Tests 96 Tests
EUR 723

Rat Neuropilin-2(NRP2) ELISA kit

CSB-EL016092RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropilin-2 (NRP2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Neuropilin-2(NRP2) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Neuropilin-2(NRP2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Neuropilin 2 (NRP2) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Neuropilin 2 (NRP2) ELISA Kit

SED042Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropilin 2 (NRP2) ELISA Kit

SED042Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropilin 2 (NRP2) ELISA Kit

SED042Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropilin 2 (NRP2) ELISA Kit

SED042Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Neuropilin 2 (NRP2) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuropilin 2 elisa. Alternative names of the recognized antigen: NP2
  • NPN2
  • VEGF165R2
  • VEGF165-R2
  • Vascular endothelial cell growth factor 165 receptor 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Neuropilin 2 (NRP2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Rat NRP2 (Neuropilin 2)

ELK7760 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuropilin 2 (NRP2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuropilin 2 (
  • Show more
Description: A sandwich ELISA kit for detection of Neuropilin 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Neuropilin 2 (NRP2) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Neuropilin 2 (NRP2) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nrp2 ELISA Kit| Rat Neuropilin-2 ELISA Kit

EF019062 96 Tests
EUR 689

Human Neuropilin-2(NRP2) ELISA kit

CSB-EL016092HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuropilin-2 (NRP2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neuropilin-2(NRP2) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuropilin-2(NRP2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Neuropilin 2 (NRP2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Neuropilin- 2, Nrp2 ELISA KIT

ELI-15030m 96 Tests
EUR 865

Human Neuropilin- 2, NRP2 ELISA KIT

ELI-46127h 96 Tests
EUR 824

Human Neuropilin 2 (NRP2) ELISA Kit

abx570530-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Mouse Neuropilin-2 (NRP2) ELISA Kit

abx390036-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Neuropilin 2(NRP2)ELISA Kit

QY-E01636 96T
EUR 361

Human Neuropilin 2 ELISA Kit (NRP2)

RK01964 96 Tests
EUR 521

Human Neuropilin 2 (NRP2) ELISA Kit

SED042Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 2 (NRP2) ELISA Kit

SED042Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 2 (NRP2) ELISA Kit

SED042Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 2 (NRP2) ELISA Kit

SED042Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 2 (NRP2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 2 (NRP2) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 2 (NRP2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuropilin 2 elisa. Alternative names of the recognized antigen: NP2
  • NPN2
  • VEGF165R2
  • VEGF165-R2
  • Vascular endothelial cell growth factor 165 receptor 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuropilin 2 (NRP2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Neuropilin 2 (NRP2) Antibody

abx026336-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody

abx026336-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neuropilin 2 (NRP2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neuropilin 2 (NRP2) Antibody

abx146242-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neuropilin 2 (NRP2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Neuropilin 2 (NRP2)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60462
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.0kDa
  • Isoelectric Point: 7.3
Description: Recombinant Human Neuropilin 2 expressed in: E.coli

Recombinant Neuropilin 2 (NRP2)

  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O35276
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.3kDa
  • Isoelectric Point: 5.3
Description: Recombinant Rat Neuropilin 2 expressed in: E.coli

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Glu652~Pro858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2)

ELISA kit for Human NRP2 (Neuropilin 2)

E-EL-H1937 1 plate of 96 wells
EUR 534
  • Gentaur's NRP2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human NRP2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human NRP2 (Neuropilin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human NRP2 (Neuropilin 2)

ELK2886 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuropilin 2 (NRP2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuropilin 2 (
  • Show more
Description: A sandwich ELISA kit for detection of Neuropilin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Nrp2 ELISA Kit| Mouse Neuropilin-2 ELISA Kit

EF015675 96 Tests
EUR 689

Human Neuropilin 2 (NRP2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Neuropilin 2 (NRP2) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neuropilin 2 (NRP2) Antibody (FITC)

  • EUR 509.00
  • EUR 258.00
  • EUR 1525.00
  • EUR 704.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Neuropilin 2 (NRP2) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Neuropilin 2 (NRP2) Antibody Pair

  • EUR 1831.00
  • EUR 1163.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Neuropilin 2 (NRP2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Glu652~Pro858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with APC.

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Glu652~Pro858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with Biotin.

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Glu652~Pro858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with Cy3.

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Glu652~Pro858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with FITC.

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Glu652~Pro858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with HRP.

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Glu652~Pro858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with PE.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Gly231~Val490)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2)

Recombinant Human Neuropilin 2/NRP2 Protein

RP00225 10 μg
EUR 230

Neuropilin 2 (NRP2) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Glu652~Pro858)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Neuropilin 2 (NRP2). This antibody is labeled with APC-Cy7.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Gly231~Val490)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with APC.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Gly231~Val490)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with Biotin.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Gly231~Val490)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with Cy3.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Gly231~Val490)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with FITC.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Gly231~Val490)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with HRP.

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Gly231~Val490)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with PE.

Nrp2/ Rat Nrp2 ELISA Kit

ELI-36829r 96 Tests
EUR 886

Neuropilin 2 (NRP2) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRP2 (Gly231~Val490)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuropilin 2 (NRP2). This antibody is labeled with APC-Cy7.

ELISA kit for Rat Neuropilin-2

EK5615 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Neuropilin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Neuropilin-2 PicoKine ELISA Kit

EK1345 96 wells
EUR 425
Description: For quantitative detection of rat Neuropilin-2 in cell culture supernates and cell lysates.

Neuropilin-2 ELISA Kit (Rat) (OKBB00614)

OKBB00614 96 Wells
EUR 505
Description: Description of target: NRP2 (Neuropilin-2), also called Npn2 or VEGF165R2, encodes a member of the neuropilin family of receptor proteins. The soluble NRP2 was secreted as a 62.5-kD protein following transfection in Chinese hamster ovary cells. The NRP2 gene is mapped to 2q33.3. The NRP2 gene contains 17 exons and spans about 112 kb. This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Mice with null mutations in genes encoding Sema3F, and its holoreceptor components Npn2 and plexin A3 (PLEXA3), exhibit increased dentate gyrus granule cell and cortical layer V pyramidal neuron spine number and size, and also aberrant spine distribution. Moreover, Sema3F promotes loss of spines and excitatory synapses in dissociated neurons in vitro, and in NRP2-null brain slices cortical layer V and dentate gyrus granule cells exhibit increased miniature excitatory postsynaptic current frequency. These disparate effects of secreted semaphorins are reflected in the restricted dendritic localization of NRP2 to apical dendrites and of Npn1 to all dendrites of cortical pyramidal neurons.;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

NRP2 ELISA Kit (Rat) (OKCD08365)

OKCD08365 96 Wells
EUR 1053
Description: Description of target: an axonal guidance molecule.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 29.2pg/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

ELISA kit for Mouse Neuropilin-2

EK5614 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Neuropilin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Neuropilin-2 PicoKine ELISA Kit

EK1344 96 wells
EUR 425
Description: For quantitative detection of mouse Neuropilin-2 in cell culture supernates and cell lysates.

Neuropilin-2 ELISA Kit (Mouse) (OKBB00613)

OKBB00613 96 Wells
EUR 505
Description: Description of target: NRP2 (Neuropilin-2), also called Npn2 or VEGF165R2, encodes a member of the neuropilin family of receptor proteins. The soluble NRP2 was secreted as a 62.5-kD protein following transfection in Chinese hamster ovary cells. The NRP2 gene is mapped to 2q33.3. The NRP2 gene contains 17 exons and spans about 112 kb. This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Mice with null mutations in genes encoding Sema3F, and its holoreceptor components Npn2 and plexin A3 (PLEXA3), exhibit increased dentate gyrus granule cell and cortical layer V pyramidal neuron spine number and size, and also aberrant spine distribution. Moreover, Sema3F promotes loss of spines and excitatory synapses in dissociated neurons in vitro, and in NRP2-null brain slices cortical layer V and dentate gyrus granule cells exhibit increased miniature excitatory postsynaptic current frequency. These disparate effects of secreted semaphorins are reflected in the restricted dendritic localization of NRP2 to apical dendrites and of Npn1 to all dendrites of cortical pyramidal neurons.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL


EF005348 96 Tests
EUR 689

Rat Neuropilin 1 (NRP1) ELISA Kit

DLR-NRP1-Ra-48T 48T
EUR 508
  • Should the Rat Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neuropilin 1 (NRP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Neuropilin 1 (NRP1) ELISA Kit

DLR-NRP1-Ra-96T 96T
EUR 661
  • Should the Rat Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Neuropilin 1 (NRP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Neuropilin 1 (NRP1) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

ELISA kit for Rat Neuropilin-1

EK5613 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Neuropilin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Neuropilin-1 PicoKine ELISA Kit

EK1343 96 wells
EUR 425
Description: For quantitative detection of rat Neuropilin-1 incell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Rat Neuropilin 1, NRP1 ELISA KIT

ELA-E1843r 96 Tests
EUR 886

Rat Neuropilin- 1, Nrp1 ELISA KIT

ELI-05928r 96 Tests
EUR 886

Rat Neuropilin 1 (NRP1) ELISA Kit

abx570667-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Neuropilin 1(NRP1)ELISA kit

QY-E10213 96T
EUR 361

Rat Neuropilin 1 (NRP1) ELISA Kit

SEA692Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 1 (NRP1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Neuropilin 1 (NRP1) ELISA Kit

SEA692Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 1 (NRP1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Neuropilin 1 (NRP1) ELISA Kit

SEA692Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 1 (NRP1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Neuropilin 1 (NRP1) ELISA Kit

SEA692Ra-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuropilin 1 (NRP1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Neuropilin 1 (NRP1) ELISA Kit

  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuropilin 1 elisa. Alternative names of the recognized antigen: CD304
  • BDCA4
  • VEGF165R
  • Vascular endothelial cell growth factor 165 receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Neuropilin 1 (NRP1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Neuropilin 1 (NRP1) ELISA Kit

RDR-NRP1-Ra-48Tests 48 Tests
EUR 534

Rat Neuropilin 1 (NRP1) ELISA Kit

RDR-NRP1-Ra-96Tests 96 Tests
EUR 742

Rat Neuropilin 1 (NRP1) ELISA Kit

RD-NRP1-Ra-48Tests 48 Tests
EUR 511

Rat Neuropilin 1 (NRP1) ELISA Kit

RD-NRP1-Ra-96Tests 96 Tests
EUR 709

Neuropilin-1 ELISA Kit (Rat) (OKBB00612)

OKBB00612 96 Wells
EUR 505
Description: Description of target: NRP1 (Neuropilin 1) also known as NP1, NRP, BDCA4 or VEGF165R, is a membrane-bound coreceptor to a tyrosine kinase receptor for both vascular endothelial growth factor (VEGF) and semaphorin family members. NRP1 plays versatile roles in angiogenesis, axon guidance, cell survival, migration, and invasion. By somatic cell hybrid analysis, the NRP1 gene was mapped to chromosome 10. NRP1 bounds PGF1 with lower affinity. NRP1-mediated interactions are a necessary element in the initiation of the primary immune response and offer another example, like that of agrin, of a molecule shared by neurologic and immunologic synapses. After T-cell contact with DC, T-cell NRP1 colocalized with CD3 in the immunologic synapse and, sometimes, also at the opposite pole of the T cell. Soluble NRP1 interacts in a homophilic fashion with NRP1 on both DC and T cells, and this binding can be inhibited by blocking antibodies to NRP1. Furthermore, selective NRP1 inhibition in this model suppressed neovascular formation substantially.;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 20 pg/mL

Neuropilin-2 Antibody

DF7604 200ul
EUR 304
Description: Neuropilin-2 Antibody detects endogenous levels of total Neuropilin-2.

Neuropilin- 2 Antibody

ABD7604 100 ug
EUR 438

NRP2 ELISA Kit (Human) (OKAN06109)

OKAN06109 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.33 ng/mL

NRP2 ELISA Kit (Human) (OKCD01252)

OKCD01252 96 Wells
EUR 831
Description: Description of target: High affinity receptor for semaphorins 3C, 3F, VEGF-165 and VEGF-145 isoforms of VEGF, and the PLGF-2 isoform of PGF. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.32 ng/mL

NRP2 ELISA Kit (Human) (OKDD00438)

OKDD00438 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.073 ng/mL

NRP2 ELISA Kit (Human) (OKEH08347)

OKEH08347 96 Wells
EUR 896
Description: Description of target: This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.15ng/mL

ELISA kit for Rat NRP1 (Neuropilin 1)

ELK3105 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuropilin 1 (NRP1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuropilin 1 (
  • Show more
Description: A sandwich ELISA kit for detection of Neuropilin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Nrp2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6940003 1.0 ug DNA
EUR 154

Rat NRP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Neuropilin-2 Polyclonal Antibody

41638-100ul 100ul
EUR 252

Neuropilin-2 Polyclonal Antibody

41638-50ul 50ul
EUR 187

Neuropilin-2 Blocking Peptide

DF7604-BP 1mg
EUR 195

Neuropilin 2 (NRP1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Neuropilin 2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Neuropilin 2 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Neuropilin-2 Polyclonal Antibody

ABP52961-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2
  • Applications tips:
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2

Neuropilin-2 Polyclonal Antibody

ABP52961-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2
  • Applications tips:
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2

Neuropilin-2 Polyclonal Antibody

ABP52961-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2
  • Applications tips:
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2

Neuropilin-2 Polyclonal Antibody

ABP56885-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2
  • Applications tips:
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2

Neuropilin-2 Polyclonal Antibody

ABP56885-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2
  • Applications tips:
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2

Neuropilin-2 Polyclonal Antibody

ABP56885-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neuropilin-2
  • Applications tips:
Description: A polyclonal antibody for detection of Neuropilin-2 from Human, Mouse, Rat. This Neuropilin-2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuropilin-2

Neuropilin-2 Polyclonal Antibody

ES7884-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Neuropilin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Neuropilin-2 Polyclonal Antibody

ES7884-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Neuropilin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Neuropilin-2 Polyclonal Antibody

ES3960-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Neuropilin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Neuropilin-2 Polyclonal Antibody

ES3960-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Neuropilin-2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-Neuropilin-2 antibody

STJ94439 200 µl
EUR 197
Description: Rabbit polyclonal to Neuropilin-2.

Anti-Neuropilin-2 antibody

STJ96595 200 µl
EUR 197
Description: Rabbit polyclonal to Neuropilin-2.

Mouse neuropilin 1 ELISA kit

ELA-E1843m 96 Tests
EUR 865

Neuropilin-1 ELISA Kit| Mouse

EF012898 96 Tests
EUR 689

Mouse Neuropilin-1 ELISA Kit

EM0146 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P97333
  • Alias: Neuropilin-1/NRP1(Neuropilin 1)/BDCA-4/CD304/BDCA4/CD304 antigen/neuropilin 1/neuropilin-1/NRPNP1/transmembrane receptor/Vascular endothelial cell growth factor 165 receptor/VEGF165R
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

NRP2 Antibody

32730-100ul 100ul
EUR 252

NRP2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

NRP2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

NRP2 Antibody

DF7032 200ul
EUR 304
Description: NRP2 Antibody detects endogenous levels of total NRP2.

NRP2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NRP2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NRP2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRP2. Recognizes NRP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NRP2 Antibody

ABD7032 100 ug
EUR 438


YF-PA15893 100 ug
EUR 403
Description: Rabbit polyclonal to NRP2


YF-PA25200 50 ul
EUR 334
Description: Mouse polyclonal to NRP2

Rat Neuropilin 1 (NRP1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Nrp2 ORF Vector (Rat) (pORF)

ORF071524 1.0 ug DNA
EUR 506

Neuropilin-2 Polyclonal Conjugated Antibody

C41638 100ul
EUR 397

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

Human Neuropilin 1 (NRP1) ELISA Kit

DLR-NRP1-Hu-48T 48T
EUR 479
  • Should the Human Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Neuropilin 1 (NRP1) ELISA Kit

DLR-NRP1-Hu-96T 96T
EUR 621
  • Should the Human Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Neuropilin 1 (NRP1) ELISA Kit

DLR-NRP1-Mu-48T 48T
EUR 489
  • Should the Mouse Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Neuropilin 1 (NRP1) ELISA Kit

DLR-NRP1-Mu-96T 96T
EUR 635
  • Should the Mouse Neuropilin 1 (NRP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Neuropilin-1(NRP1) ELISA kit

CSB-EL016091HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuropilin-1 (NRP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neuropilin-1(NRP1) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuropilin-1(NRP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Neuropilin 1 (NRP1) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neuropilin 1 (NRP1) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Neuropilin 1 (NRP1) ELISA Kit

abx254519-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human Neuropilin 1 (NRP1) ELISA Kit

abx251281-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

ELISA kit for Human Neuropilin-1

EK5621 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Neuropilin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse Neuropilin-1

EK4012 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Neuropilin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Neuropilin-1 PicoKine ELISA Kit

EK1342 96 wells
EUR 425
Description: For quantitative detection of mouse Neuropilin-1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Neuropilin-1 PicoKine ELISA Kit

EK1353 96 wells
EUR 455
Description: For quantitative detection of human Neuropilin-1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse Nrp1/ Neuropilin-1 ELISA Kit

E1058Mo 1 Kit
EUR 571

Human NRP1/ Neuropilin-1 ELISA Kit

E1795Hu 1 Kit
EUR 571

Human NRP1(Neuropilin-1) ELISA Kit

EH1959 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: O14786
  • Alias: NRP1(Neuropilin 1)/BDCA-4/CD304/BDCA4/CD304 antigen/neuropilin 1/neuropilin-1/NRPNP1/transmembrane receptor/Vascular endothelial cell growth factor 165 receptor/VEGF165R
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Mouse Neuropilin- 1, Nrp1 ELISA KIT

ELI-05926m 96 Tests
EUR 865

Chicken Neuropilin- 1, NRP1 ELISA KIT

ELI-05927c 96 Tests
EUR 928

Human Neuropilin- 1, NRP1 ELISA KIT

ELI-05929h 96 Tests
EUR 824

Monkey Neuropilin 1 (NRP1) ELISA Kit

abx360321-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Neuropilin 1 (NRP1) ELISA Kit

abx361065-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Neuropilin 1 (NRP1) ELISA Kit

abx356821-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Neuropilin 1 (NRP1) ELISA Kit

abx363821-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Neuropilin 1 (NRP1) ELISA Kit

abx570645-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Neuropilin 1 (NRP1) ELISA Kit

abx572321-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Chicken Neuropilin 1 (NRP1) ELISA Kit

abx518590-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Neuropilin 1(NRP1)ELISA Kit

QY-E01637 96T
EUR 361

Human Neuropilin 1 (NRP1) ELISA Kit

SEA692Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 1 (NRP1) ELISA Kit

SEA692Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 1 (NRP1) ELISA Kit

SEA692Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 1 (NRP1) ELISA Kit

SEA692Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Human Neuropilin 1 (NRP1) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuropilin 1 elisa. Alternative names of the recognized antigen: CD304
  • BDCA4
  • VEGF165R
  • Vascular endothelial cell growth factor 165 receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Neuropilin 1 (NRP1) ELISA Kit

SEA692Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Neuropilin 1 (NRP1) ELISA Kit

SEA692Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Neuropilin 1 (NRP1) ELISA Kit

SEA692Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Neuropilin 1 (NRP1) ELISA Kit

SEA692Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neuropilin 1 (NRP1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neuropilin 1 (NRP1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Neuropilin 1 (NRP1) ELISA Kit

  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuropilin 1 elisa. Alternative names of the recognized antigen: CD304
  • BDCA4
  • VEGF165R
  • Vascular endothelial cell growth factor 165 receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Neuropilin 1 (NRP1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Neuropilin 1 ELISA Kit (NRP1)

RK03079 96 Tests
EUR 521

Mouse Neuropilin 1(NRP1)ELISA kit

QY-E21079 96T
EUR 361

Human Neuropilin 1 (NRP1) ELISA Kit

RDR-NRP1-Hu-48Tests 48 Tests
EUR 500

Human Neuropilin 1 (NRP1) ELISA Kit

RDR-NRP1-Hu-96Tests 96 Tests
EUR 692

Mouse Neuropilin 1 (NRP1) ELISA Kit

RDR-NRP1-Mu-48Tests 48 Tests
EUR 511

Mouse Neuropilin 1 (NRP1) ELISA Kit

RDR-NRP1-Mu-96Tests 96 Tests
EUR 709

Human Neuropilin 1 (NRP1) ELISA Kit

RD-NRP1-Hu-48Tests 48 Tests
EUR 478

Human Neuropilin 1 (NRP1) ELISA Kit

RD-NRP1-Hu-96Tests 96 Tests
EUR 662

Mouse Neuropilin 1 (NRP1) ELISA Kit

RD-NRP1-Mu-48Tests 48 Tests
EUR 489

Mouse Neuropilin 1 (NRP1) ELISA Kit

RD-NRP1-Mu-96Tests 96 Tests
EUR 677

Neuropilin-1 ELISA Kit (Mouse) (OKBB00611)

OKBB00611 96 Wells
EUR 505
Description: Description of target: NRP1 (Neuropilin 1) also known as NP1, NRP, BDCA4 or VEGF165R, is a membrane-bound coreceptor to a tyrosine kinase receptor for both vascular endothelial growth factor (VEGF) and semaphorin family members. NRP1 plays versatile roles in angiogenesis, axon guidance, cell survival, migration, and invasion. By somatic cell hybrid analysis, the NRP1 gene was mapped to chromosome 10. NRP1 bounds PGF1 with lower affinity. NRP1-mediated interactions are a necessary element in the initiation of the primary immune response and offer another example, like that of agrin, of a molecule shared by neurologic and immunologic synapses. After T-cell contact with DC, T-cell NRP1 colocalized with CD3 in the immunologic synapse and, sometimes, also at the opposite pole of the T cell. Soluble NRP1 interacts in a homophilic fashion with NRP1 on both DC and T cells, and this binding can be inhibited by blocking antibodies to NRP1. Furthermore, selective NRP1 inhibition in this model suppressed neovascular formation substantially.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 20 pg/mL

Neuropilin-1 ELISA Kit (Human) (OKBB00667)

OKBB00667 96 Wells
EUR 544
Description: Description of target: NRP1 (Neuropilin 1) also known as NP1, NRP, BDCA4 or VEGF165R, is a membrane-bound coreceptor to a tyrosine kinase receptor for both vascular endothelial growth factor (VEGF) and semaphorin family members. NRP1 plays versatile roles in angiogenesis, axon guidance, cell survival, migration, and invasion. By somatic cell hybrid analysis, the NRP1 gene was mapped to chromosome 10. NRP1 bounds PGF1 with lower affinity. NRP1-mediated interactions are a necessary element in the initiation of the primary immune response and offer another example, like that of agrin, of a molecule shared by neurologic and immunologic synapses. After T-cell contact with DC, T-cell NRP1 colocalized with CD3 in the immunologic synapse and, sometimes, also at the opposite pole of the T cell. Soluble NRP1 interacts in a homophilic fashion with NRP1 on both DC and T cells, and this binding can be inhibited by blocking antibodies to NRP1. Furthermore, selective NRP1 inhibition in this model suppressed neovascular formation substantially.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 20 pg/mL

Neuropilin antibody

10R-10590 100 ug
EUR 349
Description: Mouse monoclonal Neuropilin antibody

Neuropilin antibody

70R-7286 50 ug
EUR 467
Description: Rabbit polyclonal Neuropilin antibody raised against the N terminal of NETO2

Neuropilin antibody

70R-7424 50 ug
EUR 467
Description: Rabbit polyclonal Neuropilin antibody raised against the N terminal of NETO2

NRP2 Rabbit pAb

A12758-100ul 100 ul
EUR 308

NRP2 Rabbit pAb

A12758-200ul 200 ul
EUR 459

NRP2 Rabbit pAb

A12758-20ul 20 ul
EUR 183

NRP2 Rabbit pAb

A12758-50ul 50 ul
EUR 223

NRP2 Blocking Peptide

DF7032-BP 1mg
EUR 195

NRP2 Conjugated Antibody

C32730 100ul
EUR 397

NRP2 cloning plasmid

CSB-CL016092HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 300
  • Sequence: atggatatgtttcctctcacctgggttttcttagccctctacttttcaagacaccaagtgagaggccaaccagacccaccgtgcggaggtcgtttgaattccaaagatgctggctatatcacctctcccggttacccccaggactacccctcccaccagaactgcgagtggattgt
  • Show more
Description: A cloning plasmid for the NRP2 gene.

NRP2 cloning plasmid

CSB-CL016092HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2781
  • Sequence: atggatatgtttcctctcacctgggttttcttagccctctacttttcaagacaccaagtgagaggccaaccagacccaccgtgcggaggtcgtttgaattccaaagatgctggctatatcacctctcccggttacccccaggactacccctcccaccagaactgcgagtggattg
  • Show more
Description: A cloning plasmid for the NRP2 gene.

NRP2 Rabbit pAb

A2581-100ul 100 ul
EUR 308

NRP2 Rabbit pAb

A2581-200ul 200 ul
EUR 459

NRP2 Rabbit pAb

A2581-20ul 20 ul
EUR 183

NRP2 Rabbit pAb

A2581-50ul 50 ul
EUR 223

Anti-NRP2 Antibody

PA1771 100ug/vial
EUR 294

Anti-NRP2 antibody

STJ24823 100 µl
EUR 277
Description: This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene.

Anti-NRP2 antibody

STJ114631 100 µl
EUR 277
Description: This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene.

Anti-NRP2 (3B8)

YF-MA16541 100 ug
EUR 363
Description: Mouse monoclonal to NRP2

Human Neuropilin and tolloid- like protein 2, NETO2 ELISA KIT

ELI-16459h 96 Tests
EUR 824

Mouse Neuropilin and tolloid- like protein 2, Neto2 ELISA KIT

ELI-44722m 96 Tests
EUR 865

Rat NRP2(Neuropilin 2) ELISA Kit