Mouse ADIG(Adipogenin) ELISA Kit

Mouse ADIG(Adipogenin) ELISA Kit

Mouse Adipogenin(ADIG) ELISA kit
E03A1272-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adipogenin (ADIG) ELISA Kit
20-abx258045	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Adipogenin, Adig ELISA KIT
ELI-49824m	Lifescience Market	96 Tests	EUR 865

Mouse Adipogenin (ADIG) ELISA Kit
SEE043Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Adipogenin (ADIG) ELISA Kit
SEE043Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Adipogenin (ADIG) ELISA Kit
SEE043Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Adipogenin (ADIG) ELISA Kit
SEE043Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Adipogenin (ADIG) ELISA Kit
4-SEE043Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Adipogenin elisa. Alternative names of the recognized antigen: SMAF1 Adipogenesis Associated Small Adipocyte Factor 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Adipogenin (ADIG) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse ADIG (Adipogenin)
ELK7532	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adipogenin (ADIG). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adipogenin (ADIG Show more
Description: A sandwich ELISA kit for detection of Adipogenin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Adipogenin (ADIG)
KTE70556-48T	Abbkine	48T	EUR 332
ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l Show more
Description: Quantitative sandwich ELISA for measuring Mouse Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Adipogenin (ADIG)
KTE70556-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l Show more
Description: Quantitative sandwich ELISA for measuring Mouse Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Adipogenin (ADIG)
KTE70556-96T	Abbkine	96T	EUR 539
ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l Show more
Description: Quantitative sandwich ELISA for measuring Mouse Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Adipogenin (ADIG) CLIA Kit
20-abx494490	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Adipogenin(ADIG) ELISA kit
E01A1272-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adipogenin(ADIG) ELISA kit
E01A1272-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adipogenin(ADIG) ELISA kit
E01A1272-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adipogenin(ADIG) ELISA kit
E02A1272-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adipogenin(ADIG) ELISA kit
E02A1272-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adipogenin(ADIG) ELISA kit
E02A1272-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adipogenin(ADIG) ELISA kit
E06A1272-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adipogenin(ADIG) ELISA kit
E06A1272-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adipogenin(ADIG) ELISA kit
E06A1272-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adipogenin(ADIG) ELISA kit
E04A1272-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adipogenin(ADIG) ELISA kit
E04A1272-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adipogenin(ADIG) ELISA kit
E04A1272-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adipogenin (ADIG) ELISA Kit
20-abx156916	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Dog Adipogenin(ADIG) ELISA kit
E08A1272-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adipogenin(ADIG) ELISA kit
E08A1272-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adipogenin(ADIG) ELISA kit
E08A1272-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adipogenin(ADIG) ELISA kit
E09A1272-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adipogenin(ADIG) ELISA kit
E09A1272-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adipogenin(ADIG) ELISA kit
E09A1272-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adipogenin(ADIG) ELISA kit
E07A1272-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adipogenin(ADIG) ELISA kit
E07A1272-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adipogenin(ADIG) ELISA kit
E07A1272-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Porcine Adipogenin, ADIG ELISA KIT
ELI-24752p	Lifescience Market	96 Tests	EUR 928

Human Adipogenin (ADIG) ELISA Kit
abx384552-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Bovine Adipogenin, ADIG ELISA KIT
ELI-34592b	Lifescience Market	96 Tests	EUR 928

Human Adipogenin, ADIG ELISA KIT
ELI-35149h	Lifescience Market	96 Tests	EUR 824

Human Adipogenin(ADIG)ELISA Kit
QY-E00227	Qayee Biotechnology	96T	EUR 361

Human Adipogenin ELISA Kit (ADIG)
RK00828	Abclonal	96 Tests	EUR 521

Human Adipogenin (ADIG) ELISA Kit
SEE043Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Human Adipogenin (ADIG) ELISA Kit
SEE043Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Human Adipogenin (ADIG) ELISA Kit
SEE043Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Human Adipogenin (ADIG) ELISA Kit
SEE043Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Human Adipogenin (ADIG) ELISA Kit
4-SEE043Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Adipogenin elisa. Alternative names of the recognized antigen: SMAF1 Adipogenesis Associated Small Adipocyte Factor 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adipogenin (ADIG) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Adig ELISA Kit| Mouse Adipogenin ELISA Kit
EF014153	Lifescience Market	96 Tests	EUR 689

Guinea pig Adipogenin(ADIG) ELISA kit
E05A1272-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adipogenin(ADIG) ELISA kit
E05A1272-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adipogenin(ADIG) ELISA kit
E05A1272-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human ADIG (Adipogenin)
ELK5260	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adipogenin (ADIG). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adipogenin (ADIG Show more
Description: A sandwich ELISA kit for detection of Adipogenin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Adipogenin (ADIG)
KTE60938-48T	Abbkine	48T	EUR 332
ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l Show more
Description: Quantitative sandwich ELISA for measuring Human Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adipogenin (ADIG)
KTE60938-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l Show more
Description: Quantitative sandwich ELISA for measuring Human Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adipogenin (ADIG)
KTE60938-96T	Abbkine	96T	EUR 539
ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l Show more
Description: Quantitative sandwich ELISA for measuring Human Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Adipogenin (ADIG) CLIA Kit
20-abx494489	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ADIG ELISA Kit| Bovine Adipogenin ELISA Kit
EF011096	Lifescience Market	96 Tests	EUR 689

Adig ELISA Kit (Mouse) (OKCD01800)
OKCD01800	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Plays a role in stimulating adipocyte differentiation and development.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL

ADIG ELISA KIT|Human
EF004579	Lifescience Market	96 Tests	EUR 689

Anti-Adipogenin (mouse) antibody
STJ73213	St John's Laboratory	100 µg	EUR 260

Adipogenin Antibody
abx431823-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Adipogenin Antibody
abx431824-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

ADIG ELISA Kit (Human) (OKCD01799)
OKCD01799	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Plays a role in stimulating adipocyte differentiation and development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.56 ng/mL

Mouse ADIG shRNA Plasmid
20-abx982832	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ADIG Recombinant Protein (Mouse)
RP114521	ABM	100 ug	Ask for price

ADIG siRNA
20-abx906864	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ADIG siRNA
20-abx906865	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Adig ORF Vector (Mouse) (pORF)
ORF038175	ABM	1.0 ug DNA	EUR 506

Anti-Adipogenin (mouse, aa41-52) antibody
STJ73215	St John's Laboratory	100 µg	EUR 359

ADIG cloning plasmid
CSB-CL001365HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 357 Sequence: atgactccagtgtgtgcttggattgggagccctggagcaaaggcccagctgagttttgctggaaggggacactccacggccaagagaaggagaggccctgctggtgagcctgctgtgccaggtgaggcacttccaggggccagggggagcctcaaggcccacccaaagccttgggc Show more
Description: A cloning plasmid for the ADIG gene.

ADIG cloning plasmid
CSB-CL001365HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 243 Sequence: ATGAAGTACCCTTTGATGCCGCTGGTGAACGACCTCACATTTTCTTTCCTGGTTTTCTGGTTCTGCCTCCCTGTGGGTTTGCTGTTGTTATTGATCATCTGGCTACGCTTCTTACTTAGCCAAGATTCAGAGGAAAATGACTCCAGTGTGTGCTTGGATTGGGAGCCCTGGAGCAA Show more
Description: A cloning plasmid for the ADIG gene.

Adig sgRNA CRISPR Lentivector set (Mouse)
K3276901	ABM	3 x 1.0 ug	EUR 339

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human ADIG shRNA Plasmid
20-abx965628	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ADIG Recombinant Protein (Human)
RP000601	ABM	100 ug	Ask for price

ADIG Recombinant Protein (Human)
RP036484	ABM	100 ug	Ask for price

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Adig sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3276902	ABM	1.0 ug DNA	EUR 154

Adig sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3276903	ABM	1.0 ug DNA	EUR 154

Adig sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3276904	ABM	1.0 ug DNA	EUR 154

ADIG Protein Vector (Mouse) (pPB-C-His)
PV152698	ABM	500 ng	EUR 603

ADIG Protein Vector (Mouse) (pPB-N-His)
PV152699	ABM	500 ng	EUR 603

ADIG Protein Vector (Mouse) (pPM-C-HA)
PV152700	ABM	500 ng	EUR 603

ADIG Protein Vector (Mouse) (pPM-C-His)
PV152701	ABM	500 ng	EUR 603

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

ADIG ORF Vector (Human) (pORF)
ORF000201	ABM	1.0 ug DNA	EUR 95

ADIG ORF Vector (Human) (pORF)
ORF012162	ABM	1.0 ug DNA	EUR 354

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

ADIG sgRNA CRISPR Lentivector set (Human)
K0050301	ABM	3 x 1.0 ug	EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Adig sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3276905	ABM	3 x 1.0 ug	EUR 376

ADIG sgRNA CRISPR Lentivector (Human) (Target 1)
K0050302	ABM	1.0 ug DNA	EUR 154

ADIG sgRNA CRISPR Lentivector (Human) (Target 2)
K0050303	ABM	1.0 ug DNA	EUR 154

ADIG sgRNA CRISPR Lentivector (Human) (Target 3)
K0050304	ABM	1.0 ug DNA	EUR 154

ADIG Protein Vector (Human) (pPB-His-MBP)
PV320118	ABM	500 ng	EUR 329

ADIG Protein Vector (Human) (pPB-His-GST)
PV320119	ABM	500 ng	EUR 329

ADIG Protein Vector (Human) (pPB-C-His)
PV000801	ABM	500 ng	EUR 329

ADIG Protein Vector (Human) (pPB-N-His)
PV000802	ABM	500 ng	EUR 329

ADIG Protein Vector (Human) (pPM-C-HA)
PV000803	ABM	500 ng	EUR 329

ADIG Protein Vector (Human) (pPM-C-His)
PV000804	ABM	500 ng	EUR 329

ADIG Protein Vector (Human) (pPB-C-His)
PV048645	ABM	500 ng	EUR 481

ADIG Protein Vector (Human) (pPB-N-His)
PV048646	ABM	500 ng	EUR 481

ADIG Protein Vector (Human) (pPM-C-HA)
PV048647	ABM	500 ng	EUR 481

ADIG Protein Vector (Human) (pPM-C-His)
PV048648	ABM	500 ng	EUR 481

Adig 3'UTR Luciferase Stable Cell Line
TU101445	ABM	1.0 ml	Ask for price

Adig 3'UTR GFP Stable Cell Line
TU151445	ABM	1.0 ml	Ask for price

ADIG 3'UTR GFP Stable Cell Line
TU050382	ABM	1.0 ml	EUR 1394

ADIG 3'UTR Luciferase Stable Cell Line
TU000382	ABM	1.0 ml	EUR 1394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Adig sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3276906	ABM	1.0 ug DNA	EUR 167

Adig sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3276907	ABM	1.0 ug DNA	EUR 167

Adig sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3276908	ABM	1.0 ug DNA	EUR 167

ADIG Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV703011	ABM	1.0 ug DNA	EUR 450

ADIG Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV703015	ABM	1.0 ug DNA	EUR 450

ADIG Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV703016	ABM	1.0 ug DNA	EUR 450

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

ADIG Protein Vector (Human) (pPM-N-D-C-HA)
PV320120	ABM	500 ng	EUR 552

ADIG Protein Vector (Human) (pPM-N-D-C-His)
PV320121	ABM	500 ng	EUR 552

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

ADIG sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0050305	ABM	3 x 1.0 ug	EUR 376

ADIG Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV703012	ABM	1.0 ug DNA	EUR 450

ADIG Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV703013	ABM	1.0 ug DNA	EUR 508

ADIG Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV703014	ABM	1.0 ug DNA	EUR 508

ADIG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0050306	ABM	1.0 ug DNA	EUR 167

ADIG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0050307	ABM	1.0 ug DNA	EUR 167

ADIG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0050308	ABM	1.0 ug DNA	EUR 167

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P	CORNING	1/pk	EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Kit ELISA Kit (Mouse) (OKBB01105)
OKBB01105	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: SCFR(Mast/stem cell growth factor receptor), also known as proto-oncogene c-Kit or tyrosine-protein kinase Kit or CD117, is a protein that in humans is encoded by the KIT gene. KIT was first described as the cellular homolog of the feline sarcoma viral oncogene v-kit. The KIT gene is mapped on 4q12. Kit was expressed on the surface of germ cells up to the pachytene stage. Signaling from the KIT receptor tyrosine kinase is essential for primordial germ cell growth both in vivo and in vitro. Determination of the KIT effectors acting in primordial germ cells has been hampered by the lack of effective methods to manipulate easily gene expression in these cells.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

KIT ELISA Kit (Mouse) (OKCD06004)
OKCD06004	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

DMD ELISA Kit| Mouse Dystrophin ELISA Kit
EF013570	Lifescience Market	96 Tests	EUR 689

DPD ELISA Kit| Mouse Deoxypyridinoline ELISA Kit
EF013573	Lifescience Market	96 Tests	EUR 689

ELN ELISA Kit| Mouse Elastin ELISA Kit
EF013582	Lifescience Market	96 Tests	EUR 689

FE ELISA Kit| Mouse Ferritin ELISA Kit
EF013594	Lifescience Market	96 Tests	EUR 689

FMOD ELISA Kit| Mouse Fibromodulin ELISA Kit
EF013602	Lifescience Market	96 Tests	EUR 689

GS ELISA Kit| Mouse Gelsolin ELISA Kit
EF013657	Lifescience Market	96 Tests	EUR 689

HAase ELISA Kit| Mouse Hyaluronidase ELISA Kit
EF013665	Lifescience Market	96 Tests	EUR 689

HB ELISA Kit| Mouse Hemoglobin ELISA Kit
EF013667	Lifescience Market	96 Tests	EUR 689

HCY ELISA Kit| Mouse Homocysteine ELISA Kit
EF013670	Lifescience Market	96 Tests	EUR 689

Hepc ELISA Kit| Mouse Hepcidin ELISA Kit
EF013675	Lifescience Market	96 Tests	EUR 689

HJV ELISA Kit| Mouse Hemojuvelin ELISA Kit
EF013678	Lifescience Market	96 Tests	EUR 689

HK ELISA Kit| Mouse Hexokinase ELISA Kit
EF013679	Lifescience Market	96 Tests	EUR 689

HP ELISA Kit| Mouse Haptoglobin ELISA Kit
EF013689	Lifescience Market	96 Tests	EUR 689

LZM ELISA Kit| Mouse Lysozyme ELISA Kit
EF013748	Lifescience Market	96 Tests	EUR 689

MAU ELISA Kit| Mouse Microalbuminuria ELISA Kit
EF013752	Lifescience Market	96 Tests	EUR 689

MHB ELISA Kit| Mouse Methemoglobin ELISA Kit
EF013756	Lifescience Market	96 Tests	EUR 689

MT ELISA Kit| Mouse Melatonin ELISA Kit
EF013768	Lifescience Market	96 Tests	EUR 689

MTL ELISA Kit| Mouse Motilin ELISA Kit
EF013769	Lifescience Market	96 Tests	EUR 689

MYO ELISA Kit| Mouse Myoglobin ELISA Kit
EF013773	Lifescience Market	96 Tests	EUR 689

NGB ELISA Kit| Mouse Neuroglobin ELISA Kit
EF013783	Lifescience Market	96 Tests	EUR 689

Pg ELISA Kit| Mouse Progesterone ELISA Kit
EF013825	Lifescience Market	96 Tests	EUR 689

PHB ELISA Kit| Mouse Prohibitin ELISA Kit
EF013829	Lifescience Market	96 Tests	EUR 689

PI ELISA Kit| Mouse Proinsulin ELISA Kit
EF013830	Lifescience Market	96 Tests	EUR 689

PP ELISA Kit| Mouse Pepsin ELISA Kit
EF013842	Lifescience Market	96 Tests	EUR 689

PS ELISA Kit| Mouse Phosphatidylserine ELISA Kit
EF013849	Lifescience Market	96 Tests	EUR 689

PTD ELISA Kit| Mouse Pentosidine ELISA Kit
EF013851	Lifescience Market	96 Tests	EUR 689

PTN ELISA Kit| Mouse Pleiotrophin ELISA Kit
EF013856	Lifescience Market	96 Tests	EUR 689

REN ELISA Kit| Mouse Renin ELISA Kit
EF013865	Lifescience Market	96 Tests	EUR 689

SCT ELISA Kit| Mouse Secretin ELISA Kit
EF013878	Lifescience Market	96 Tests	EUR 689

SYP ELISA Kit| Mouse Synaptophysin ELISA Kit
EF013911	Lifescience Market	96 Tests	EUR 689

TG ELISA Kit| Mouse Thyroglobulin ELISA Kit
EF013933	Lifescience Market	96 Tests	EUR 689

TLN ELISA Kit| Mouse Talin ELISA Kit
EF013937	Lifescience Market	96 Tests	EUR 689

TM ELISA Kit| Mouse Thrombomodulin ELISA Kit
EF013939	Lifescience Market	96 Tests	EUR 689

TRF ELISA Kit| Mouse Transferrin ELISA Kit
EF013948	Lifescience Market	96 Tests	EUR 689

TRY ELISA Kit| Mouse Trypsin ELISA Kit
EF013951	Lifescience Market	96 Tests	EUR 689

TTR ELISA Kit| Mouse Transthyretin ELISA Kit
EF013954	Lifescience Market	96 Tests	EUR 689

Ub ELISA Kit| Mouse Ubiquitin ELISA Kit
EF013956	Lifescience Market	96 Tests	EUR 689

VF ELISA Kit| Mouse Visfatin ELISA Kit
EF013963	Lifescience Market	96 Tests	EUR 689

CCK ELISA Kit| Mouse Cholecystokinin ELISA Kit
EF013984	Lifescience Market	96 Tests	EUR 689

His ELISA Kit| Mouse Histamine ELISA Kit
EF013995	Lifescience Market	96 Tests	EUR 689

AMPKa ELISA Kit| Mouse pThr172 ELISA Kit
EF013997	Lifescience Market	96 Tests	EUR 689

PCT ELISA Kit| Mouse Procalcitonin ELISA Kit
EF014005	Lifescience Market	96 Tests	EUR 689

TE ELISA Kit| Mouse Telomerase ELISA Kit
EF014029	Lifescience Market	96 Tests	EUR 689

Mouse ADIG(Adipogenin) ELISA Kit