Mouse ADIG(Adipogenin) ELISA Kit

Mouse ADIG(Adipogenin) ELISA Kit

Mouse Adipogenin(ADIG) ELISA kit

E03A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Adipogenin, Adig ELISA KIT

ELI-49824m 96 Tests
EUR 865

Mouse Adipogenin (ADIG) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Adipogenin (ADIG) ELISA Kit

SEE043Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Adipogenin (ADIG) ELISA Kit

SEE043Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Adipogenin (ADIG) ELISA Kit

SEE043Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Adipogenin (ADIG) ELISA Kit

SEE043Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Adipogenin (ADIG) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Adipogenin elisa. Alternative names of the recognized antigen: SMAF1
  • Adipogenesis Associated
  • Small Adipocyte Factor 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Adipogenin (ADIG) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse ADIG (Adipogenin)

ELK7532 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adipogenin (ADIG). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adipogenin (ADIG
  • Show more
Description: A sandwich ELISA kit for detection of Adipogenin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Adipogenin (ADIG)

KTE70556-48T 48T
EUR 332
  • ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Adipogenin (ADIG)

KTE70556-5platesof96wells 5 plates of 96 wells
EUR 2115
  • ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Adipogenin (ADIG)

KTE70556-96T 96T
EUR 539
  • ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Adipogenin (ADIG) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Goat Adipogenin(ADIG) ELISA kit

E06A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adipogenin(ADIG) ELISA kit

E06A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Adipogenin(ADIG) ELISA kit

E06A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adipogenin(ADIG) ELISA kit

E02A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adipogenin(ADIG) ELISA kit

E02A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Adipogenin(ADIG) ELISA kit

E02A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adipogenin(ADIG) ELISA kit

E04A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adipogenin(ADIG) ELISA kit

E04A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Adipogenin(ADIG) ELISA kit

E04A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adipogenin(ADIG) ELISA kit

E01A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adipogenin(ADIG) ELISA kit

E01A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Adipogenin(ADIG) ELISA kit

E01A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adipogenin(ADIG) ELISA kit

E08A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adipogenin(ADIG) ELISA kit

E08A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Adipogenin(ADIG) ELISA kit

E08A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adipogenin(ADIG) ELISA kit

E07A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adipogenin(ADIG) ELISA kit

E07A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Adipogenin(ADIG) ELISA kit

E07A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adipogenin(ADIG) ELISA kit

E09A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adipogenin(ADIG) ELISA kit

E09A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Adipogenin(ADIG) ELISA kit

E09A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Porcine Adipogenin, ADIG ELISA KIT

ELI-24752p 96 Tests
EUR 928

Bovine Adipogenin, ADIG ELISA KIT

ELI-34592b 96 Tests
EUR 928

Human Adipogenin, ADIG ELISA KIT

ELI-35149h 96 Tests
EUR 824

Human Adipogenin (ADIG) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Adipogenin (ADIG) ELISA Kit

abx384552-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Adipogenin ELISA Kit (ADIG)

RK00828 96 Tests
EUR 521

Human Adipogenin(ADIG)ELISA Kit

QY-E00227 96T
EUR 361

Human Adipogenin (ADIG) ELISA Kit

SEE043Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Human Adipogenin (ADIG) ELISA Kit

SEE043Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Human Adipogenin (ADIG) ELISA Kit

SEE043Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Human Adipogenin (ADIG) ELISA Kit

SEE043Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adipogenin (ADIG) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adipogenin (ADIG) in Tissue homogenates, cell lysates and other biological fluids.

Human Adipogenin (ADIG) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Adipogenin elisa. Alternative names of the recognized antigen: SMAF1
  • Adipogenesis Associated
  • Small Adipocyte Factor 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adipogenin (ADIG) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Adig ELISA Kit| Mouse Adipogenin ELISA Kit

EF014153 96 Tests
EUR 689

Guinea pig Adipogenin(ADIG) ELISA kit

E05A1272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adipogenin(ADIG) ELISA kit

E05A1272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Adipogenin(ADIG) ELISA kit

E05A1272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Adipogenin(ADIG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human ADIG (Adipogenin)

ELK5260 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adipogenin (ADIG). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adipogenin (ADIG
  • Show more
Description: A sandwich ELISA kit for detection of Adipogenin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Adipogenin (ADIG)

KTE60938-48T 48T
EUR 332
  • ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adipogenin (ADIG)

KTE60938-5platesof96wells 5 plates of 96 wells
EUR 2115
  • ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adipogenin (ADIG)

KTE60938-96T 96T
EUR 539
  • ADIG/SMAF1 is an adipocyte-specific protein that plays a role in adipocyte differentiation. The deduced 80-amino acid mouse protein contains an N-terminal region rich in leucine residues, a short stretch of basic amino acids suggestive of a nuclear l
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adipogenin (ADIG) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Adipogenin (ADIG) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ADIG ELISA Kit| Bovine Adipogenin ELISA Kit

EF011096 96 Tests
EUR 689

Adig ELISA Kit (Mouse) (OKCD01800)

OKCD01800 96 Wells
EUR 857
Description: Description of target: Plays a role in stimulating adipocyte differentiation and development.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL


EF004579 96 Tests
EUR 689

Anti-Adipogenin (mouse) antibody

STJ73213 100 µg
EUR 260

Adipogenin Antibody

abx431823-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Adipogenin Antibody

abx431824-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

ADIG ELISA Kit (Human) (OKCD01799)

OKCD01799 96 Wells
EUR 831
Description: Description of target: Plays a role in stimulating adipocyte differentiation and development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.56 ng/mL

Mouse ADIG shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADIG Recombinant Protein (Mouse)

RP114521 100 ug Ask for price


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Adig ORF Vector (Mouse) (pORF)

ORF038175 1.0 ug DNA
EUR 506

Anti-Adipogenin (mouse, aa41-52) antibody

STJ73215 100 µg
EUR 359

ADIG cloning plasmid

CSB-CL001365HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 357
  • Sequence: atgactccagtgtgtgcttggattgggagccctggagcaaaggcccagctgagttttgctggaaggggacactccacggccaagagaaggagaggccctgctggtgagcctgctgtgccaggtgaggcacttccaggggccagggggagcctcaaggcccacccaaagccttgggc
  • Show more
Description: A cloning plasmid for the ADIG gene.

ADIG cloning plasmid

CSB-CL001365HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 243
  • Show more
Description: A cloning plasmid for the ADIG gene.

Adig sgRNA CRISPR Lentivector set (Mouse)

K3276901 3 x 1.0 ug
EUR 339

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human ADIG shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADIG Recombinant Protein (Human)

RP000601 100 ug Ask for price

ADIG Recombinant Protein (Human)

RP036484 100 ug Ask for price

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Adig sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3276902 1.0 ug DNA
EUR 154

Adig sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3276903 1.0 ug DNA
EUR 154

Adig sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3276904 1.0 ug DNA
EUR 154

ADIG Protein Vector (Mouse) (pPB-C-His)

PV152698 500 ng
EUR 603

ADIG Protein Vector (Mouse) (pPB-N-His)

PV152699 500 ng
EUR 603

ADIG Protein Vector (Mouse) (pPM-C-HA)

PV152700 500 ng
EUR 603

ADIG Protein Vector (Mouse) (pPM-C-His)

PV152701 500 ng
EUR 603

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

ADIG ORF Vector (Human) (pORF)

ORF000201 1.0 ug DNA
EUR 95

ADIG ORF Vector (Human) (pORF)

ORF012162 1.0 ug DNA
EUR 354

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

ADIG sgRNA CRISPR Lentivector set (Human)

K0050301 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Adig sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3276905 3 x 1.0 ug
EUR 376

ADIG sgRNA CRISPR Lentivector (Human) (Target 1)

K0050302 1.0 ug DNA
EUR 154

ADIG sgRNA CRISPR Lentivector (Human) (Target 2)

K0050303 1.0 ug DNA
EUR 154

ADIG sgRNA CRISPR Lentivector (Human) (Target 3)

K0050304 1.0 ug DNA
EUR 154

ADIG Protein Vector (Human) (pPB-C-His)

PV000801 500 ng
EUR 329

ADIG Protein Vector (Human) (pPB-N-His)

PV000802 500 ng
EUR 329

ADIG Protein Vector (Human) (pPM-C-HA)

PV000803 500 ng
EUR 329

ADIG Protein Vector (Human) (pPM-C-His)

PV000804 500 ng
EUR 329

ADIG Protein Vector (Human) (pPB-C-His)

PV048645 500 ng
EUR 481

ADIG Protein Vector (Human) (pPB-N-His)

PV048646 500 ng
EUR 481

ADIG Protein Vector (Human) (pPM-C-HA)

PV048647 500 ng
EUR 481

ADIG Protein Vector (Human) (pPM-C-His)

PV048648 500 ng
EUR 481

ADIG Protein Vector (Human) (pPB-His-MBP)

PV320118 500 ng
EUR 329

ADIG Protein Vector (Human) (pPB-His-GST)

PV320119 500 ng
EUR 329

Adig 3'UTR GFP Stable Cell Line

TU151445 1.0 ml Ask for price

ADIG 3'UTR Luciferase Stable Cell Line

TU000382 1.0 ml
EUR 1394

Adig 3'UTR Luciferase Stable Cell Line

TU101445 1.0 ml Ask for price

ADIG 3'UTR GFP Stable Cell Line

TU050382 1.0 ml
EUR 1394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Adig sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3276906 1.0 ug DNA
EUR 167

Adig sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3276907 1.0 ug DNA
EUR 167

Adig sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3276908 1.0 ug DNA
EUR 167

ADIG Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV703011 1.0 ug DNA
EUR 450

ADIG Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV703015 1.0 ug DNA
EUR 450

ADIG Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV703016 1.0 ug DNA
EUR 450

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

ADIG Protein Vector (Human) (pPM-N-D-C-HA)

PV320120 500 ng
EUR 552

ADIG Protein Vector (Human) (pPM-N-D-C-His)

PV320121 500 ng
EUR 552

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

ADIG sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0050305 3 x 1.0 ug
EUR 376

ADIG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0050306 1.0 ug DNA
EUR 167

ADIG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0050307 1.0 ug DNA
EUR 167

ADIG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0050308 1.0 ug DNA
EUR 167

ADIG Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV703012 1.0 ug DNA
EUR 450

ADIG Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV703013 1.0 ug DNA
EUR 508

ADIG Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV703014 1.0 ug DNA
EUR 508


EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

KIT ELISA Kit (Mouse) (OKCD06004)

OKCD06004 96 Wells
EUR 779
Description: Description of target: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

Kit ELISA Kit (Mouse) (OKBB01105)

OKBB01105 96 Wells
EUR 505
Description: Description of target: SCFR(Mast/stem cell growth factor receptor), also known as proto-oncogene c-Kit or tyrosine-protein kinase Kit or CD117, is a protein that in humans is encoded by the KIT gene. KIT was first described as the cellular homolog of the feline sarcoma viral oncogene v-kit. The KIT gene is mapped on 4q12. Kit was expressed on the surface of germ cells up to the pachytene stage. Signaling from the KIT receptor tyrosine kinase is essential for primordial germ cell growth both in vivo and in vitro. Determination of the KIT effectors acting in primordial germ cells has been hampered by the lack of effective methods to manipulate easily gene expression in these cells.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Cygb ELISA Kit| Mouse Cytoglobin ELISA Kit

EF014614 96 Tests
EUR 689

Dfnb31 ELISA Kit| Mouse Whirlin ELISA Kit

EF014640 96 Tests
EUR 689

Dmkn ELISA Kit| Mouse Dermokine ELISA Kit

EF014677 96 Tests
EUR 689

Dstn ELISA Kit| Mouse Destrin ELISA Kit

EF014680 96 Tests
EUR 689

Dpys ELISA Kit| Mouse Dihydropyrimidinase ELISA Kit

EF014695 96 Tests
EUR 689

Dixdc1 ELISA Kit| Mouse Dixin ELISA Kit

EF014715 96 Tests
EUR 689

Dbn1 ELISA Kit| Mouse Drebrin ELISA Kit

EF014734 96 Tests
EUR 689

Dym ELISA Kit| Mouse Dymeclin ELISA Kit

EF014745 96 Tests
EUR 689

Dysf ELISA Kit| Mouse Dysferlin ELISA Kit

EF014753 96 Tests
EUR 689

Dst ELISA Kit| Mouse Dystonin ELISA Kit

EF014755 96 Tests
EUR 689

Dtnbp1 ELISA Kit| Mouse Dysbindin ELISA Kit

EF014756 96 Tests
EUR 689

Dag1 ELISA Kit| Mouse Dystroglycan ELISA Kit

EF014757 96 Tests
EUR 689

Emb ELISA Kit| Mouse Embigin ELISA Kit

EF014774 96 Tests
EUR 689

Emd ELISA Kit| Mouse Emerin ELISA Kit

EF014776 96 Tests
EUR 689

Enam ELISA Kit| Mouse Enamelin ELISA Kit

EF014778 96 Tests
EUR 689

Emcn ELISA Kit| Mouse Endomucin ELISA Kit

EF014779 96 Tests
EUR 689

Enho ELISA Kit| Mouse Adropin ELISA Kit

EF014792 96 Tests
EUR 689

Evpl ELISA Kit| Mouse Envoplakin ELISA Kit

EF014798 96 Tests
EUR 689

Eppin ELISA Kit| Mouse Eppin ELISA Kit

EF014811 96 Tests
EUR 689

Ermn ELISA Kit| Mouse Ermin ELISA Kit

EF014824 96 Tests
EUR 689

Espn ELISA Kit| Mouse Espin ELISA Kit

EF014828 96 Tests
EUR 689

Espl1 ELISA Kit| Mouse Separin ELISA Kit

EF014864 96 Tests
EUR 689

Fign ELISA Kit| Mouse Fidgetin ELISA Kit

EF014932 96 Tests
EUR 689

Flcn ELISA Kit| Mouse Folliculin ELISA Kit

EF014951 96 Tests
EUR 689

Fktn ELISA Kit| Mouse Fukutin ELISA Kit

EF014984 96 Tests
EUR 689

Fah ELISA Kit| Mouse Fumarylacetoacetase ELISA Kit

EF014986 96 Tests
EUR 689

Galk1 ELISA Kit| Mouse Galactokinase ELISA Kit

EF015008 96 Tests
EUR 689

Galc ELISA Kit| Mouse Galactocerebrosidase ELISA Kit

EF015012 96 Tests
EUR 689

Gpbp1 ELISA Kit| Mouse Vasculin ELISA Kit

EF015023 96 Tests
EUR 689

Gmnn ELISA Kit| Mouse Geminin ELISA Kit

EF015026 96 Tests
EUR 689

Gan ELISA Kit| Mouse Gigaxonin ELISA Kit

EF015031 96 Tests
EUR 689

Glmn ELISA Kit| Mouse Glomulin ELISA Kit

EF015037 96 Tests
EUR 689

Gca ELISA Kit| Mouse Grancalcin ELISA Kit

EF015092 96 Tests
EUR 689

Hemgn ELISA Kit| Mouse Hemogen ELISA Kit

EF015158 96 Tests
EUR 689

Hdlbp ELISA Kit| Mouse Vigilin ELISA Kit

EF015180 96 Tests
EUR 689

Invs ELISA Kit| Mouse Inversin ELISA Kit

EF015284 96 Tests
EUR 689

Kalrn ELISA Kit| Mouse Kalirin ELISA Kit

EF015312 96 Tests
EUR 689

Khk ELISA Kit| Mouse Ketohexokinase ELISA Kit

EF015321 96 Tests
EUR 689

Kynu ELISA Kit| Mouse Kynureninase ELISA Kit

EF015331 96 Tests
EUR 689

Lxn ELISA Kit| Mouse Latexin ELISA Kit

EF015348 96 Tests
EUR 689

Layn ELISA Kit| Mouse Layilin ELISA Kit

EF015349 96 Tests
EUR 689

Lca5 ELISA Kit| Mouse Lebercilin ELISA Kit

EF015350 96 Tests
EUR 689

Lpxn ELISA Kit| Mouse Leupaxin ELISA Kit

EF015377 96 Tests
EUR 689

Mouse ADIG(Adipogenin) ELISA Kit