Human TMEM176B(Transmembrane Protein 176B) ELISA Kit
Human Transmembrane Protein 176B (TMEM176B) ELISA Kit |
SEM863Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids. |
Human Transmembrane Protein 176B (TMEM176B) ELISA Kit |
4-SEM863Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Transmembrane Protein 176B elisa. Alternative names of the recognized antigen: LR8
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transmembrane Protein 176B (TMEM176B) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Transmembrane Protein 176B (TMEM176B) Antibody |
abx238762-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Transmembrane Protein 176B (TMEM176B) Antibody |
20-abx302903 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Transmembrane protein 176B, Tmem176b ELISA KIT |
ELI-13710m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Transmembrane Protein 176B (TMEM176B) CLIA Kit |
20-abx496077 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human TMEM176B (Transmembrane Protein 176B) |
ELK7461 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transmembrane Protein 176B (TMEM176B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
- Show more
|
Description: A sandwich ELISA kit for detection of Transmembrane Protein 176B from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Transmembrane Protein 176B (TMEM176B) Antibody (HRP) |
20-abx305617 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Transmembrane Protein 176B (TMEM176B) Antibody (FITC) |
20-abx305618 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Transmembrane Protein 176B (TMEM176B) Antibody (Biotin) |
20-abx305619 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Transmembrane Protein 176B (THEM176B) Antibody |
20-abx116243 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMEM176B Recombinant Protein (Human) |
RP032020 |
ABM |
100 ug |
Ask for price |
TMEM176B siRNA |
20-abx905644 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMEM176B siRNA |
20-abx937161 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMEM176B siRNA |
20-abx937162 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TMEM176B antibody |
70R-20872 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TMEM176B antibody |
TMEM176B antibody |
70R-8537 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal TMEM176B antibody |
TMEM176B Antibody |
1-CSB-PA023758GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against TMEM176B. Recognizes TMEM176B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
TMEM176B Antibody |
1-CSB-PA023758LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TMEM176B. Recognizes TMEM176B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
TMEM176B Recombinant Protein (Rat) |
RP233612 |
ABM |
100 ug |
Ask for price |
TMEM176B Recombinant Protein (Mouse) |
RP179444 |
ABM |
100 ug |
Ask for price |
TMEM176B Recombinant Protein (Mouse) |
RP179447 |
ABM |
100 ug |
Ask for price |
TMEM176B Recombinant Protein (Mouse) |
RP179450 |
ABM |
100 ug |
Ask for price |
TMEM176B Recombinant Protein (Mouse) |
RP179453 |
ABM |
100 ug |
Ask for price |
Human TMEM176B shRNA Plasmid |
20-abx959128 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human Transmembrane protein 119 ELISA kit |
E01T0877-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 119 ELISA kit |
E01T0877-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Transmembrane protein 119 ELISA kit |
E01T0877-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
TMEM176B cloning plasmid |
CSB-CL023758HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 813
- Sequence: atgacgcaaaacacggtgattgtgaatggagttgctatggcctctaggccatcccagcccacccacgtcaacgtccacatccaccaggagtcagctttgacacaactgctgaaagctggaggttctctgaagaagtttctttttcaccctggggacactgtgccttccacagccag
- Show more
|
Description: A cloning plasmid for the TMEM176B gene. |
anti- TMEM176B antibody |
FNab08762 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:200-1:1000
- IP: 1:500-1:1000
- Immunogen: transmembrane protein 176B
- Uniprot ID: Q3YBM2
- Gene ID: 28959
- Research Area: Signal Transduction, Metabolism, Developmental biology
|
Description: Antibody raised against TMEM176B |
TMEM176B Polyclonal Antibody |
A61382 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
TMEM176B Rabbit pAb |
A16118-100ul |
Abclonal |
100 ul |
EUR 308 |
TMEM176B Rabbit pAb |
A16118-200ul |
Abclonal |
200 ul |
EUR 459 |
Human TMEM176B(Transmembrane Protein 176B) ELISA Kit