Human TMEM176B(Transmembrane Protein 176B) ELISA Kit

Human TMEM176B(Transmembrane Protein 176B) ELISA Kit

Human Transmembrane Protein 176B (TMEM176B) ELISA Kit

SEM863Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transmembrane Protein 176B (TMEM176B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transmembrane Protein 176B (TMEM176B) in tissue homogenates, cell lysates and other biological fluids.

Human Transmembrane Protein 176B (TMEM176B) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transmembrane Protein 176B elisa. Alternative names of the recognized antigen: LR8
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transmembrane Protein 176B (TMEM176B) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Transmembrane Protein 176B (TMEM176B) Antibody

abx238762-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Transmembrane Protein 176B (TMEM176B) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Transmembrane protein 176B, Tmem176b ELISA KIT

ELI-13710m 96 Tests
EUR 865

Human Transmembrane Protein 176B (TMEM176B) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human TMEM176B (Transmembrane Protein 176B)

ELK7461 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transmembrane Protein 176B (TMEM176B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Transmembrane Protein 176B from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Transmembrane Protein 176B (TMEM176B) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transmembrane Protein 176B (TMEM176B) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transmembrane Protein 176B (TMEM176B) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transmembrane Protein 176B (THEM176B) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tmem176b/ Rat Tmem176b ELISA Kit

ELI-29945r 96 Tests
EUR 886


EF003665 96 Tests
EUR 689

TMEM176B ELISA Kit (Human) (OKCD02076)

OKCD02076 96 Wells
EUR 909
Description: Description of target: May play a role in the process of maturation of dendritic cells. Required for the development of cerebellar granule cells.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.59 ng/mL

TMEM176B Recombinant Protein (Human)

RP032020 100 ug Ask for price


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMEM176B antibody

70R-20872 50 ul
EUR 435
Description: Rabbit polyclonal TMEM176B antibody

TMEM176B antibody

70R-8537 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TMEM176B antibody

TMEM176B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMEM176B. Recognizes TMEM176B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TMEM176B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM176B. Recognizes TMEM176B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

TMEM176B Recombinant Protein (Rat)

RP233612 100 ug Ask for price

TMEM176B Recombinant Protein (Mouse)

RP179444 100 ug Ask for price

TMEM176B Recombinant Protein (Mouse)

RP179447 100 ug Ask for price

TMEM176B Recombinant Protein (Mouse)

RP179450 100 ug Ask for price

TMEM176B Recombinant Protein (Mouse)

RP179453 100 ug Ask for price

Human TMEM176B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Transmembrane protein 119 ELISA kit

E01T0877-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 119 ELISA kit

E01T0877-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transmembrane protein 119 ELISA kit

E01T0877-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Transmembrane protein 119 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TMEM176B cloning plasmid

CSB-CL023758HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 813
  • Sequence: atgacgcaaaacacggtgattgtgaatggagttgctatggcctctaggccatcccagcccacccacgtcaacgtccacatccaccaggagtcagctttgacacaactgctgaaagctggaggttctctgaagaagtttctttttcaccctggggacactgtgccttccacagccag
  • Show more
Description: A cloning plasmid for the TMEM176B gene.

anti- TMEM176B antibody

FNab08762 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:500-1:1000
  • Immunogen: transmembrane protein 176B
  • Uniprot ID: Q3YBM2
  • Gene ID: 28959
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against TMEM176B

TMEM176B Polyclonal Antibody

A61382 100 µg
EUR 570.55
Description: The best epigenetics products

TMEM176B Rabbit pAb

A16118-100ul 100 ul
EUR 308

Human TMEM176B(Transmembrane Protein 176B) ELISA Kit