Human DBNL(Drebrin Like Protein) ELISA Kit

Human DBNL(Drebrin Like Protein) ELISA Kit

Human Drebrin Like Protein (DBNL) ELISA Kit

SEL448Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.

Human Drebrin Like Protein (DBNL) ELISA Kit

SEL448Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.

Human Drebrin Like Protein (DBNL) ELISA Kit

SEL448Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.

Human Drebrin Like Protein (DBNL) ELISA Kit

SEL448Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin Like Protein (DBNL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin Like Protein (DBNL) in Tissue homogenates, cell lysates and other biological fluids.

Human Drebrin Like Protein (DBNL) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Drebrin Like Protein elisa. Alternative names of the recognized antigen: ABP1
  • HIP-55
  • SH3P7
  • CMAP
  • Cervical mucin-associated protein
  • Drebrin-F
  • HPK1-interacting protein of 55 kDa
  • SH3 domain-containing protein 7
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Drebrin Like Protein (DBNL) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Drebrin-Like Protein (DBNL) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Drebrin Like Protein (DBNL) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Drebrin-Like Protein (DBNL) Antibody

abx029164-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Drebrin-Like Protein (DBNL) Antibody

abx029164-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Drebrin-Like Protein (DBNL) Antibody

abx232257-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Bovine Drebrin- like protein, DBNL ELISA KIT

ELI-09045b 96 Tests
EUR 928

Mouse Drebrin- like protein, Dbnl ELISA KIT

ELI-26391m 96 Tests
EUR 865

Rat Drebrin Like Protein (DBNL) ELISA Kit

abx391250-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Drebrin Like Protein (DBNL) ELISA Kit

abx389105-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Drebrin Like Protein (DBNL) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human DBNL (Drebrin Like Protein)

ELK7533 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Drebrin Like Protein (DBNL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Drebri
  • Show more
Description: A sandwich ELISA kit for detection of Drebrin Like Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Dbnl ELISA Kit| Rat Drebrin-like protein ELISA Kit

EF018605 96 Tests
EUR 689

Dbnl ELISA Kit| Mouse Drebrin-like protein ELISA Kit

EF014735 96 Tests
EUR 689

DBNL ELISA Kit| Bovine Drebrin-like protein ELISA Kit

EF011332 96 Tests
EUR 689

Dbnl/ Rat Dbnl ELISA Kit

ELI-07872r 96 Tests
EUR 886


EF009020 96 Tests
EUR 689

Human Drebrin, DBN1 ELISA KIT

ELI-09340h 96 Tests
EUR 824

Human Drebrin 1 (DBN1) ELISA Kit

DLR-DBN1-Hu-48T 48T
EUR 517
  • Should the Human Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit

DLR-DBN1-Hu-96T 96T
EUR 673
  • Should the Human Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Drebrin 1(DBN1)ELISA Kit

QY-E01394 96T
EUR 361

Human Drebrin 1 (DBN1) ELISA Kit

RDR-DBN1-Hu-48Tests 48 Tests
EUR 544

Human Drebrin 1 (DBN1) ELISA Kit

RDR-DBN1-Hu-96Tests 96 Tests
EUR 756

Human Drebrin 1 (DBN1) ELISA Kit

SEC431Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit

SEC431Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit

SEC431Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit

SEC431Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Drebrin 1 (DBN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Drebrin 1 (DBN1) in Tissue homogenates and other biological fluids.

Human Drebrin 1 (DBN1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Drebrin 1 elisa. Alternative names of the recognized antigen: Developmentally-regulated brain protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Drebrin 1 (DBN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Drebrin 1 (DBN1) ELISA Kit

RD-DBN1-Hu-48Tests 48 Tests
EUR 521

Human Drebrin 1 (DBN1) ELISA Kit

RD-DBN1-Hu-96Tests 96 Tests
EUR 723

DBNL Recombinant Protein (Human)

RP008788 100 ug Ask for price

DBNL Recombinant Protein (Human)

RP008791 100 ug Ask for price

Mouse Drebrin, Dbn1 ELISA KIT

ELI-08819m 96 Tests
EUR 865

Chicken Drebrin, DBN1 ELISA KIT

ELI-48161c 96 Tests
EUR 928

ELISA kit for Human DBN1 (Drebrin 1)

ELK3701 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Drebrin 1 (DBN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Drebrin 1 (DBN1).
  • Show more
Description: A sandwich ELISA kit for detection of Drebrin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Dbn1 ELISA Kit| Rat Drebrin ELISA Kit

EF018604 96 Tests
EUR 689

Dbn1 ELISA Kit| Mouse Drebrin ELISA Kit

EF014734 96 Tests
EUR 689

DBN1 ELISA Kit| chicken Drebrin ELISA Kit

EF012286 96 Tests
EUR 689

Human Drebrin 1 (DBN1) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Drebrin antibody

20R-DP003 100 uL
EUR 510
Description: Guinea Pig polyclonal Drebrin antibody

Drebrin antibody

20R-DP004 100 uL
EUR 510
Description: Guinea Pig polyclonal Drebrin antibody

Drebrin antibody

10R-2460 5 mL
EUR 405
Description: Mouse monoclonal Drebrin antibody

Drebrin antibody

10R-D117a 100 ug
EUR 570
Description: Mouse monoclonal Drebrin antibody

Drebrin antibody

10R-D117b 250 uL
EUR 483
Description: Mouse monoclonal Drebrin antibody

Drebrin Antibody

DF12388 200ul
EUR 304
Description: Drebrin antibody detects endogenous levels of Drebrin.

Drebrin Antibody

abx139395-01mg 0.1 mg
EUR 425
  • Shipped within 5-12 working days.

Drebrin Antibody

abx232535-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Drebrin Antibody

abx232536-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Mouse Drebrin 1 (DBN1) ELISA Kit

DLR-DBN1-Mu-48T 48T
EUR 527
  • Should the Mouse Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Mouse Drebrin 1 (DBN1) ELISA Kit

DLR-DBN1-Mu-96T 96T
EUR 688
  • Should the Mouse Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Rat Drebrin 1 (DBN1) ELISA Kit

DLR-DBN1-Ra-48T 48T
EUR 549
  • Should the Rat Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Rat Drebrin 1 (DBN1) ELISA Kit

DLR-DBN1-Ra-96T 96T
EUR 718
  • Should the Rat Drebrin 1 (DBN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Drebrin 1 (DBN1) in samples from tissue homogenates or other biological fluids.

Mouse Drebrin 1 (DBN1) ELISA Kit

abx576649-96tests 96 tests
EUR 864
  • Shipped within 5-12 working days.

Rat Drebrin 1 (DBN1) ELISA Kit

abx576683-96tests 96 tests
EUR 895
  • Shipped within 5-12 working days.

Mouse Drebrin 1 (DBN1) ELISA Kit

RDR-DBN1-Mu-48Tests 48 Tests
EUR 557

Mouse Drebrin 1 (DBN1) ELISA Kit

RDR-DBN1-Mu-96Tests 96 Tests
EUR 774

Rat Drebrin 1 (DBN1) ELISA Kit

RDR-DBN1-Ra-48Tests 48 Tests
EUR 583

Rat Drebrin 1 (DBN1) ELISA Kit

RDR-DBN1-Ra-96Tests 96 Tests
EUR 811

Mouse Drebrin 1 (DBN1) ELISA Kit

RD-DBN1-Mu-48Tests 48 Tests
EUR 533

Mouse Drebrin 1 (DBN1) ELISA Kit

RD-DBN1-Mu-96Tests 96 Tests
EUR 740

Rat Drebrin 1 (DBN1) ELISA Kit

RD-DBN1-Ra-48Tests 48 Tests
EUR 557

Rat Drebrin 1 (DBN1) ELISA Kit

RD-DBN1-Ra-96Tests 96 Tests
EUR 775

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

DBNL antibody

70R-16749 50 ul
EUR 435
Description: Rabbit polyclonal DBNL antibody

DBNL antibody

70R-2474 50 ug
EUR 467
Description: Rabbit polyclonal DBNL antibody raised against the middle region of DBNL

DBNL Antibody

DF12594 200ul
EUR 304
Description: DBNL Antibody detects endogenous levels of DBNL.

DBNL Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DBNL. Recognizes DBNL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human Drebrin 1 (DBN1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

DBNL Recombinant Protein (Rat)

RP197375 100 ug Ask for price

DBNL Recombinant Protein (Mouse)

RP127943 100 ug Ask for price

DBNL Recombinant Protein (Mouse)

RP127946 100 ug Ask for price

DBNL Recombinant Protein (Mouse)

RP127949 100 ug Ask for price

Human DBNL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-Drebrin Purified

11-694-C025 0.025 mg
EUR 122

Anti-Drebrin Purified

11-694-C100 0.1 mg
EUR 204

Anti-Drebrin PE

1P-694-T025 25 tests
EUR 140

Anti-Drebrin PE

1P-694-T100 100 tests
EUR 240

Drebrin Blocking Peptide

DF12388-BP 1mg
EUR 195

Drebrin (DBN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Drebrin Antibody (PE)

abx139396-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

anti- Drebrin antibody

FNab02535 100µg
EUR 505.25
  • Immunogen: drebrin 1
  • Uniprot ID: Q16643
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against Drebrin

anti- Drebrin antibody

FNab02536 100µg
EUR 585
  • Immunogen: drebrin 1
  • Uniprot ID: Q16643
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against Drebrin

Anti-Drebrin antibody

PAab02535 100 ug
EUR 355

Anti-Drebrin antibody

PAab02536 100 ug
EUR 412

Anti-Drebrin (2E11)

YF-MA12638 100 ug
EUR 363
Description: Mouse monoclonal to Drebrin

DBNL Polyclonal Antibody

28333-100ul 100ul
EUR 252

DBNL Polyclonal Antibody

28333-50ul 50ul
EUR 187

DBNL Rabbit pAb

A13751-100ul 100 ul
EUR 308

DBNL Rabbit pAb

A13751-200ul 200 ul
EUR 459

DBNL Rabbit pAb

A13751-20ul 20 ul
EUR 183

DBNL Rabbit pAb

A13751-50ul 50 ul
EUR 223

DBNL Blocking Peptide

33R-7539 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DBNL antibody, catalog no. 70R-2474

DBNL cloning plasmid

CSB-CL892128HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1293
  • Sequence: atggcggcgaacctgagccggaacgggccagcgctgcaagaggcctacgtgcgggtggtcaccgagaagtccccgaccgactgggctctctttacctatgaaggcaacagcaatgacatccgcgtggctggcacaggggagggtggcctggaggagatggtggaggagctcaaca
  • Show more
Description: A cloning plasmid for the DBNL gene.

DBNL cloning plasmid

CSB-CL892128HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1296
  • Sequence: atggcggcgaacctgagccggaacgggccagcgctgcaagaggcctacgtgcgggtggtcaccgagaagtccccgaccgactgggctctctttacctatgaaggcaacagcaatgacatccgcgtggctggcacaggggagggtggcctggaggagatggtggaggagctcaaca
  • Show more
Description: A cloning plasmid for the DBNL gene.

DBNL Blocking Peptide

DF12594-BP 1mg
EUR 195

DBNL Rabbit pAb

A4663-100ul 100 ul
EUR 308

DBNL Rabbit pAb

A4663-200ul 200 ul
EUR 459

DBNL Rabbit pAb

A4663-20ul 20 ul Ask for price

DBNL Rabbit pAb

A4663-50ul 50 ul Ask for price

anti- DBNL antibody

FNab02257 100µg
EUR 505.25
  • Immunogen: drebrin-like
  • Uniprot ID: Q9UJU6
  • Gene ID: 28988
  • Research Area: Signal Transduction
Description: Antibody raised against DBNL

Anti-DBNL antibody

PAab02257 100 ug
EUR 355

Anti-DBNL antibody

STJ115699 100 µl
EUR 277

Anti-DBNL antibody

STJ23342 100 µl
EUR 277

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

DBNL ORF Vector (Human) (pORF)

ORF002930 1.0 ug DNA
EUR 95

DBNL ORF Vector (Human) (pORF)

ORF002931 1.0 ug DNA
EUR 95

DBNL Protein Vector (Human) (pPB-C-His)

PV011717 500 ng
EUR 329

DBNL Protein Vector (Human) (pPB-N-His)

PV011718 500 ng
EUR 329

DBNL Protein Vector (Human) (pPM-C-HA)

PV011719 500 ng
EUR 329

DBNL Protein Vector (Human) (pPM-C-His)

PV011720 500 ng
EUR 329

DBNL Protein Vector (Human) (pPB-C-His)

PV011721 500 ng
EUR 329

DBNL Protein Vector (Human) (pPB-N-His)

PV011722 500 ng
EUR 329

DBNL Protein Vector (Human) (pPM-C-HA)

PV011723 500 ng
EUR 329

DBNL Protein Vector (Human) (pPM-C-His)

PV011724 500 ng
EUR 329

Drebrin 1 (DBN1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Drebrin 1 (DBN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Drebrin 1 (DBN1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Drebrin recombinant monoclonal antibody

A5309 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human Drebrin for WB,ELISA

Recombinant Drebrin 1 (DBN1)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16643
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Drebrin 1 expressed in: E.coli

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Rat DBNL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DBNL Polyclonal Conjugated Antibody

C28333 100ul
EUR 397

Mouse DBNL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

DBNL sgRNA CRISPR Lentivector set (Human)

K0563501 3 x 1.0 ug
EUR 339

Anti-Drebrin Rabbit Monoclonal Antibody

M05530 100ug/vial
EUR 397
Description: Rabbit Monoclonal Drebrin Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-Drebrin Monoclonal Antibody (M2F6)

M05530-1 100ug
EUR 420
Description: Mouse Monoclonal Drebrin Antibody (M2F6). Validated in IP, IF, WB and tested in Mouse, Rat.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1)

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

DBNL Protein Vector (Mouse) (pPB-C-His)

PV170594 500 ng
EUR 603

DBNL Protein Vector (Mouse) (pPB-N-His)

PV170595 500 ng
EUR 603

DBNL Protein Vector (Mouse) (pPM-C-HA)

PV170596 500 ng
EUR 603

DBNL Protein Vector (Mouse) (pPM-C-His)

PV170597 500 ng
EUR 603

DBNL Protein Vector (Mouse) (pPB-C-His)

PV170598 500 ng
EUR 603

DBNL Protein Vector (Mouse) (pPB-N-His)

PV170599 500 ng
EUR 603

DBNL Protein Vector (Mouse) (pPM-C-HA)

PV170600 500 ng
EUR 603

DBNL Protein Vector (Mouse) (pPM-C-His)

PV170601 500 ng
EUR 603

DBNL Protein Vector (Mouse) (pPB-C-His)

PV170602 500 ng
EUR 603

DBNL Protein Vector (Mouse) (pPB-N-His)

PV170603 500 ng
EUR 603

DBNL Protein Vector (Mouse) (pPM-C-HA)

PV170604 500 ng
EUR 603

DBNL Protein Vector (Mouse) (pPM-C-His)

PV170605 500 ng
EUR 603

DBNL Protein Vector (Rat) (pPB-C-His)

PV263170 500 ng
EUR 603

DBNL Protein Vector (Rat) (pPB-N-His)

PV263171 500 ng
EUR 603

DBNL Protein Vector (Rat) (pPM-C-HA)

PV263172 500 ng
EUR 603

DBNL Protein Vector (Rat) (pPM-C-His)

PV263173 500 ng
EUR 603

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Polyclonal DBNL Antibody (C-term)

APR15689G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DBNL (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal DBNL Antibody (C-term)

APR15690G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DBNL (C-term). This antibody is tested and proven to work in the following applications:

Dbnl ORF Vector (Rat) (pORF)

ORF065793 1.0 ug DNA
EUR 506

Dbnl ORF Vector (Mouse) (pORF)

ORF042649 1.0 ug DNA
EUR 506

Dbnl ORF Vector (Mouse) (pORF)

ORF042650 1.0 ug DNA
EUR 506

Dbnl ORF Vector (Mouse) (pORF)

ORF042651 1.0 ug DNA
EUR 506

DBNL sgRNA CRISPR Lentivector (Human) (Target 1)

K0563502 1.0 ug DNA
EUR 154

DBNL sgRNA CRISPR Lentivector (Human) (Target 2)

K0563503 1.0 ug DNA
EUR 154

DBNL sgRNA CRISPR Lentivector (Human) (Target 3)

K0563504 1.0 ug DNA
EUR 154

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with APC.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with Biotin.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with Cy3.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with FITC.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with HRP.

Drebrin 1 (DBN1) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DBN1 (Gly3~Ser134 )
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Drebrin 1 (DBN1). This antibody is labeled with PE.

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

DBNL Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV791419 1.0 ug DNA
EUR 316

DBNL Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV791420 1.0 ug DNA
EUR 316

DBNL Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV791421 1.0 ug DNA
EUR 316

DBNL Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV791425 1.0 ug DNA
EUR 316

DBNL Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV791426 1.0 ug DNA
EUR 316

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Dbnl sgRNA CRISPR Lentivector set (Rat)

K7018601 3 x 1.0 ug
EUR 339

Dbnl sgRNA CRISPR Lentivector set (Mouse)

K3381901 3 x 1.0 ug
EUR 339

Human Crk Like Protein (CRKL) ELISA Kit

EUR 517
  • Should the Human Crk Like Protein (CRKL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Crk Like Protein (CRKL) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Crk Like Protein (CRKL) ELISA Kit

EUR 673
  • Should the Human Crk Like Protein (CRKL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Crk Like Protein (CRKL) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Meteorin-like protein(METRNL) ELISA kit

CSB-EL013718HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Meteorin-like protein (METRNL) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Meteorin-like protein(METRNL) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Meteorin-like protein(METRNL) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human BET1 like protein(BET1L) ELISA kit

E01B0793-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human BET1 like protein(BET1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human BET1 like protein(BET1L) ELISA kit

E01B0793-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human BET1 like protein(BET1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human BET1 like protein(BET1L) ELISA kit

E01B0793-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human BET1 like protein(BET1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DBNL(Drebrin Like Protein) ELISA Kit