Mouse QPRT(Quinolinate Phosphoribosyltransferase) ELISA Kit
Mouse Quinolinate Phosphoribosyltransferase (QPRT) ELISA Kit |
SED403Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Quinolinate Phosphoribosyltransferase (QPRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Quinolinate Phosphoribosyltransferase (QPRT) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Quinolinate Phosphoribosyltransferase (QPRT) ELISA Kit |
SED403Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Quinolinate Phosphoribosyltransferase (QPRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Quinolinate Phosphoribosyltransferase (QPRT) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Quinolinate Phosphoribosyltransferase (QPRT) ELISA Kit |
SED403Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Quinolinate Phosphoribosyltransferase (QPRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inte
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Quinolinate Phosphoribosyltransferase (QPRT) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Quinolinate Phosphoribosyltransferase (QPRT) ELISA Kit |
4-SED403Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Quinolinate Phosphoribosyltransferase elisa. Alternative names of the recognized antigen: QPRTase
- Nicotinate-Nucleotide Pyrophosphorylase(Carboxylating)
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Quinolinate Phosphoribosyltransferase (QPRT) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Quinolinate Phosphoribosyltransferase (QPRT) Antibody |
abx028016-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Quinolinate Phosphoribosyltransferase (QPRT) Antibody |
abx028016-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Quinolinate Phosphoribosyltransferase (QPRT) Antibody |
abx236984-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Mouse Quinolinate Phosphoribosyltransferase (QPRT) CLIA Kit |
20-abx494252 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Quinolinate Phosphoribosyltransferase (QPRT) ELISA Kit |
abx382591-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Quinolinate Phosphoribosyltransferase (QPRT) ELISA Kit |
abx391879-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Quinolinate Phosphoribosyltransferase(QPRT)ELISA Kit |
QY-E02422 |
Qayee Biotechnology |
96T |
EUR 361 |
ELISA kit for Mouse QPRT (Quinolinate Phosphoribosyltransferase) |
ELK7445 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Quinolinate Phosphoribosyltransferase (QPRT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
- Show more
|
Description: A sandwich ELISA kit for detection of Quinolinate Phosphoribosyltransferase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Quinolinate Phosphoribosyltransferase-Decarboxylating (QPRT) Antibody |
31247-05111 |
AssayPro |
150 ug |
EUR 261 |
QPRT Quinolinate Phosphoribosyltransferase Human Recombinant Protein |
PROTQ15274 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: QPRT Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 317 amino acids (1-297 a.a.) and having a molecular mass of 32.9 kDa. The QPRT is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques. |
Human Quinolinate Phosphoribosyltransferase-Decarboxylating (QPRT) Antibody (Biotin Conjugate) |
31247-05121 |
AssayPro |
150 ug |
EUR 369 |
Human Quinolinate Phosphoribosyltransferase-Decarboxylating (QPRT) AssayLite Antibody (FITC Conjugate) |
31247-05141 |
AssayPro |
150 ug |
EUR 428 |
Human Quinolinate Phosphoribosyltransferase-Decarboxylating (QPRT) AssayLite Antibody (RPE Conjugate) |
31247-05151 |
AssayPro |
150 ug |
EUR 428 |
Human Quinolinate Phosphoribosyltransferase-Decarboxylating (QPRT) AssayLite Antibody (APC Conjugate) |
31247-05161 |
AssayPro |
150 ug |
EUR 428 |
Human Quinolinate Phosphoribosyltransferase-Decarboxylating (QPRT) AssayLite Antibody (PerCP Conjugate) |
31247-05171 |
AssayPro |
150 ug |
EUR 471 |
Quinolinate Phosphoribosyltransferase (Recombinant) |
20-abx073320 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Recombinant Human Quinolinate Phosphoribosyltransferase |
7-03538 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Quinolinate Phosphoribosyltransferase |
7-03539 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Human Quinolinate Phosphoribosyltransferase |
7-03540 |
CHI Scientific |
1mg |
Ask for price |
Recombinant Human Quinolinate Phosphoribosyltransferase/QPRTase (N-6His) |
C257-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 8.0 . |
Recombinant Human Quinolinate Phosphoribosyltransferase/QPRTase (N-6His) |
C257-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 8.0 . |
Recombinant Human Quinolinate Phosphoribosyltransferase/QPRTase (N-6His) |
C257-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 8.0 . |
Recombinant Human Quinolinate Phosphoribosyltransferase/QPRTase (N-6His) |
C257-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 8.0 . |
Qprt ELISA Kit| Mouse Nicotinate-nucleotide pyrophosphorylase [ |
EF016018 |
Lifescience Market |
96 Tests |
EUR 689 |
Human QPRT AssayMax ELISA Kit |
EQ2210-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Mouse Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E03N0539-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E03N0539-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E03N0539-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Adenine phosphoribosyltransferase(APRT) ELISA kit |
E03A1610-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Adenine phosphoribosyltransferase(APRT) ELISA kit |
E03A1610-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Adenine phosphoribosyltransferase(APRT) ELISA kit |
E03A1610-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse orotate phosphoribosyltransferase (OPRT) ELISA kit |
E03O0750-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse orotate phosphoribosyltransferase (OPRT) ELISA kit |
E03O0750-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse orotate phosphoribosyltransferase (OPRT) ELISA kit |
E03O0750-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Nampt/ Nicotinamide phosphoribosyltransferase ELISA Kit |
E1008Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse Nicotinamide phosphoribosyltransferase, Nampt ELISA KIT |
ELI-02264m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Adenine phosphoribosyltransferase, Aprt ELISA KIT |
ELI-49220m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
abx388512-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse QPRT shRNA Plasmid |
20-abx976110 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
QPRT Recombinant Protein (Mouse) |
RP166091 |
ABM |
100 ug |
Ask for price |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Mouse Qprt(Nicotinate-nucleotide pyrophosphorylase [carboxylating]) ELISA Kit |
EM1714 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78.125-5000 pg/ml
- Alias: Qprt/quinolinate phosphoribosyltransferase,HEL-S-90n/ QPRTase/ nicotinate-nucleotide pyrophosphorylase [carboxylating]/ epididymis secretory sperm binding protein Li 90n/ nicotinate-nucleotide pyrophosphoryla
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.875pg/ml |
Mouse Nicotinate-nucleotide pyrophosphorylase [carboxylating] (Qprt) ELISA Kit |
abx259294-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
ELISA kit for Mouse Nicotinate-nucleotide pyrophosphorylase (QPRT) |
KTE70584-48T |
Abbkine |
48T |
EUR 332 |
- Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Nicotinate-nucleotide pyrophosphorylase (QPRT) |
KTE70584-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Nicotinate-nucleotide pyrophosphorylase (QPRT) |
KTE70584-96T |
Abbkine |
96T |
EUR 539 |
- Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
QPRT siRNA |
20-abx904401 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
QPRT siRNA |
20-abx930550 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
QPRT siRNA |
20-abx930551 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
QPRT antibody |
10R-5552 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal QPRT antibody |
QPRT antibody |
10R-5553 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal QPRT antibody |
QPRT antibody |
10R-5554 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal QPRT antibody |
QPRT antibody |
10R-5556 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal QPRT antibody |
QPRT antibody |
10R-5557 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal QPRT antibody |
QPRT antibody |
10R-5559 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal QPRT antibody |
QPRT Antibody |
1-CSB-PA621868LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against QPRT. Recognizes QPRT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200 |
anti-QPRT |
YF-PA17904 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to QPRT |
anti-QPRT |
YF-PA17905 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to QPRT |
anti-QPRT |
YF-PA17906 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to QPRT |
anti-QPRT |
YF-PA17907 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to QPRT |
anti-QPRT |
YF-PA17908 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to QPRT |
anti-QPRT |
YF-PA25898 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to QPRT |
Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit |
abx570666-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Uracil phosphoribosyltransferase homolog(UPRT) ELISA kit |
E03U0053-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Uracil phosphoribosyltransferase homolog(UPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Uracil phosphoribosyltransferase homolog(UPRT) ELISA kit |
E03U0053-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Uracil phosphoribosyltransferase homolog(UPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Uracil phosphoribosyltransferase homolog(UPRT) ELISA kit |
E03U0053-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Uracil phosphoribosyltransferase homolog(UPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Hprt1/ Hypoxanthine-guanine phosphoribosyltransferase ELISA Kit |
E0692Mo |
Sunlong |
1 Kit |
EUR 632 |
Mouse Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit |
E03H1375-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit |
E03H1375-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Hypoxanthine guanine phosphoribosyltransferase(HPRT1) ELISA kit |
E03H1375-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Hypoxanthine guanine phosphoribosyltransferase(HPRT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Uracil phosphoribosyltransferase homolog, Uprt ELISA KIT |
ELI-44713m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit |
20-abx154151 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit |
DLR-HPRT1-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit |
DLR-HPRT1-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in samples from tissue homogenates, cell lysates or other biological fluids. |
ELISA kit for Mouse Nicotinamide phosphoribosyltransferase (NAMPT) |
KTE70831-48T |
Abbkine |
48T |
EUR 354 |
- Nicotinamide phosphoribosyltransferase (NAmPRTase or Nampt) also known as pre-B-cell colony-enhancing factor 1 (PBEF1) or visfatin is an enzyme that in humans is encoded by the PBEF1 gene. This protein is the rate-limiting enzyme in the nNicotinamide
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Nicotinamide phosphoribosyltransferase (NAMPT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Nicotinamide phosphoribosyltransferase (NAMPT) |
KTE70831-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Nicotinamide phosphoribosyltransferase (NAmPRTase or Nampt) also known as pre-B-cell colony-enhancing factor 1 (PBEF1) or visfatin is an enzyme that in humans is encoded by the PBEF1 gene. This protein is the rate-limiting enzyme in the nNicotinamide
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Nicotinamide phosphoribosyltransferase (NAMPT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Nicotinamide phosphoribosyltransferase (NAMPT) |
KTE70831-96T |
Abbkine |
96T |
EUR 572 |
- Nicotinamide phosphoribosyltransferase (NAmPRTase or Nampt) also known as pre-B-cell colony-enhancing factor 1 (PBEF1) or visfatin is an enzyme that in humans is encoded by the PBEF1 gene. This protein is the rate-limiting enzyme in the nNicotinamide
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Nicotinamide phosphoribosyltransferase (NAMPT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit |
SEA717Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit |
SEA717Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit |
SEA717Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit |
SEA717Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
-
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in serum, plasma, tissue homogenates and other biological fluids. |
Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit |
4-SEA717Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Hypoxanthine Phosphoribosyltransferase 1 elisa. Alternative names of the recognized antigen: HGPRT
- HGPRTase
- HPRT
- Lesch-Nyhan Syndrome
- Hypoxanthine-guanine phosphoribosyltransferase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit |
RD-HPRT1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit |
RD-HPRT1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit |
RDR-HPRT1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) ELISA Kit |
RDR-HPRT1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Aprt ELISA Kit| Mouse Adenine phosphoribosyltransferase ELISA K |
EF014137 |
Lifescience Market |
96 Tests |
EUR 689 |
Qprt ORF Vector (Mouse) (pORF) |
ORF055365 |
ABM |
1.0 ug DNA |
EUR 506 |
ELISA kit for Mouse HPRT1 (Hypoxanthine Phosphoribosyltransferase 1) |
ELK3104 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Hypoxanthine Phosphoribosyltransferase 1 (HPRT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibo
- Show more
|
Description: A sandwich ELISA kit for detection of Hypoxanthine Phosphoribosyltransferase 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
QPRT ELISA Kit| Bovine Nicotinate-nucleotide pyrophosphorylase |
EF011830 |
Lifescience Market |
96 Tests |
EUR 689 |
anti- QPRT antibody |
FNab06984 |
FN Test |
100µg |
EUR 585 |
- Immunogen: quinolinate phosphoribosyltransferase
- Uniprot ID: Q15274
- Gene ID: 23475
- Research Area: Metabolism
|
Description: Antibody raised against QPRT |
QPRT Rabbit pAb |
A14349-100ul |
Abclonal |
100 ul |
EUR 308 |
QPRT Rabbit pAb |
A14349-200ul |
Abclonal |
200 ul |
EUR 459 |
QPRT Rabbit pAb |
A14349-20ul |
Abclonal |
20 ul |
EUR 183 |
QPRT Rabbit pAb |
A14349-50ul |
Abclonal |
50 ul |
EUR 223 |
QPRT Polyclonal Antibody |
28521-100ul |
SAB |
100ul |
EUR 252 |
QPRT Polyclonal Antibody |
28521-50ul |
SAB |
50ul |
EUR 187 |
QPRT cloning plasmid |
CSB-CL621868HU1-10ug |
Cusabio |
10ug |
EUR 360 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 894
- Sequence: atggacgctgaaggcctggcgctgctgctgccgcccgtcaccctggcagccctggtggacagctggctccgagaggactgcccagggctcaactacgcagccttggtcagcggggcaggcccctcgcaggcggcgctgtgggccaaatcccctgggatactggcagggcagccttt
- Show more
|
Description: A cloning plasmid for the QPRT gene. |
QPRT cloning plasmid |
CSB-CL621868HU2-10ug |
Cusabio |
10ug |
EUR 360 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 894
- Sequence: atggacgctgaaggcctggcgctgctgctgccgcccgtcaccctggcagccctggtggacagctggctccgagaggactgcccagggctcaactacgcagccttggtcagcggggcaggcccctcgcaggcggcgctgtgggccaaatcccctggggtactggcagggcagccttt
- Show more
|
Description: A cloning plasmid for the QPRT gene. |
anti-QPRT (5D11) |
LF-MA10263 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to QPRT |
Anti-QPRT antibody |
STJ116561 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a key enzyme in catabolism of quinolinate, an intermediate in the tryptophan-nicotinamide adenine dinucleotide pathway. Quinolinate acts as a most potent endogenous exitotoxin to neurons. Elevation of quinolinate levels in the brain has been linked to the pathogenesis of neurodegenerative disorders such as epilepsy, Alzheimer's disease, and Huntington's disease. Alternative splicing results in multiple transcript variants. |
Rat Nampt/ Nicotinamide phosphoribosyltransferase ELISA Kit |
E0659Ra |
Sunlong |
1 Kit |
EUR 571 |
Goat Adenine phosphoribosyltransferase(APRT) ELISA kit |
E06A1610-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Adenine phosphoribosyltransferase(APRT) ELISA kit |
E06A1610-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Adenine phosphoribosyltransferase(APRT) ELISA kit |
E06A1610-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E02N0539-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E02N0539-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E02N0539-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E01N0539-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E01N0539-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E01N0539-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat orotate phosphoribosyltransferase (OPRT) ELISA kit |
E02O0750-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat orotate phosphoribosyltransferase (OPRT) ELISA kit |
E02O0750-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat orotate phosphoribosyltransferase (OPRT) ELISA kit |
E02O0750-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Adenine phosphoribosyltransferase(APRT) ELISA kit |
E04A1610-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Adenine phosphoribosyltransferase(APRT) ELISA kit |
E04A1610-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Adenine phosphoribosyltransferase(APRT) ELISA kit |
E04A1610-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E04N0539-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E04N0539-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E04N0539-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit orotate phosphoribosyltransferase (OPRT) ELISA kit |
E04O0750-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit orotate phosphoribosyltransferase (OPRT) ELISA kit |
E04O0750-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit orotate phosphoribosyltransferase (OPRT) ELISA kit |
E04O0750-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Adenine phosphoribosyltransferase(APRT) ELISA kit |
E01A1610-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Adenine phosphoribosyltransferase(APRT) ELISA kit |
E01A1610-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Adenine phosphoribosyltransferase(APRT) ELISA kit |
E01A1610-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Adenine phosphoribosyltransferase(APRT) ELISA kit |
E02A1610-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Adenine phosphoribosyltransferase(APRT) ELISA kit |
E02A1610-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Adenine phosphoribosyltransferase(APRT) ELISA kit |
E02A1610-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human orotate phosphoribosyltransferase (OPRT) ELISA kit |
E01O0750-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human orotate phosphoribosyltransferase (OPRT) ELISA kit |
E01O0750-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human orotate phosphoribosyltransferase (OPRT) ELISA kit |
E01O0750-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Adenine phosphoribosyltransferase(APRT) ELISA kit |
E07A1610-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Adenine phosphoribosyltransferase(APRT) ELISA kit |
E07A1610-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Adenine phosphoribosyltransferase(APRT) ELISA kit |
E07A1610-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E08N0539-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E08N0539-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E08N0539-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat orotate phosphoribosyltransferase (OPRT) ELISA kit |
E06O0750-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat orotate phosphoribosyltransferase (OPRT) ELISA kit |
E06O0750-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat orotate phosphoribosyltransferase (OPRT) ELISA kit |
E06O0750-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Adenine phosphoribosyltransferase(APRT) ELISA kit |
E09A1610-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Adenine phosphoribosyltransferase(APRT) ELISA kit |
E09A1610-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Adenine phosphoribosyltransferase(APRT) ELISA kit |
E09A1610-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E09N0539-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E09N0539-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E09N0539-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Adenine phosphoribosyltransferase(APRT) ELISA kit |
E08A1610-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Adenine phosphoribosyltransferase(APRT) ELISA kit |
E08A1610-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Adenine phosphoribosyltransferase(APRT) ELISA kit |
E08A1610-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Adenine phosphoribosyltransferase(APRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E07N0539-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E07N0539-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E07N0539-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E06N0539-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E06N0539-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit |
E06N0539-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig orotate phosphoribosyltransferase (OPRT) ELISA kit |
E07O0750-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig orotate phosphoribosyltransferase (OPRT) ELISA kit |
E07O0750-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig orotate phosphoribosyltransferase (OPRT) ELISA kit |
E07O0750-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog orotate phosphoribosyltransferase (OPRT) ELISA kit |
E08O0750-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog orotate phosphoribosyltransferase (OPRT) ELISA kit |
E08O0750-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog orotate phosphoribosyltransferase (OPRT) ELISA kit |
E08O0750-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human NAMPT/ Nicotinamide phosphoribosyltransferase ELISA Kit |
E2812Hu |
Sunlong |
1 Kit |
EUR 563 |
Monkey orotate phosphoribosyltransferase (OPRT) ELISA kit |
E09O0750-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey orotate phosphoribosyltransferase (OPRT) ELISA kit |
E09O0750-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey orotate phosphoribosyltransferase (OPRT) ELISA kit |
E09O0750-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey orotate phosphoribosyltransferase (OPRT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human NAMPT(Nicotinamide phosphoribosyltransferase) ELISA Kit |
EH0651 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: P43490
- Alias: VF(Visfatin)/NAMPT/NAmPRTase/NMPRTase/PBEF1/Visfatin/NAmPRTase/Nampt/nicotinamide phosphoribosyltransferase/Pre-B cell-enhancing factor/pre-B-cell colony enhancing factor 1/Pre-B-cell colony-e
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Bovine Adenine phosphoribosyltransferase, APRT ELISA KIT |
ELI-24357b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Adenine phosphoribosyltransferase, APRT ELISA KIT |
ELI-24358h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Nicotinamide phosphoribosyltransferase, NAMPT ELISA KIT |
ELI-02262h |
Lifescience Market |
96 Tests |
EUR 824 |
Porcine Nicotinamide phosphoribosyltransferase, NAMPT ELISA KIT |
ELI-02263p |
Lifescience Market |
96 Tests |
EUR 928 |
Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit |
20-abx153440 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
20-abx150726 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Nicotinate Phosphoribosyltransferase (NAPRT1) ELISA Kit |
abx381683-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
abx390931-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
DLR-APRT-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenine Phosphoribosyltransferase (APRT) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
DLR-APRT-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenine Phosphoribosyltransferase (APRT) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit |
DLR-UPRT-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Uracil Phosphoribosyltransferase (UPRT) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit |
DLR-UPRT-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Uracil Phosphoribosyltransferase (UPRT) in samples from tissue homogenates, cell lysates or other biological fluids. |
Pig NAMPT/ Nicotinamide phosphoribosyltransferase ELISA Kit |
E0138Pi |
Sunlong |
1 Kit |
EUR 717 |
Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
SEC310Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenine Phosphoribosyltransferase (APRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenine Phosphoribosyltransferase (APRT) in Tissue homogenates, cell lysates and other biological fluids. |
Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
SEC310Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenine Phosphoribosyltransferase (APRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenine Phosphoribosyltransferase (APRT) in Tissue homogenates, cell lysates and other biological fluids. |
Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
SEC310Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenine Phosphoribosyltransferase (APRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenine Phosphoribosyltransferase (APRT) in Tissue homogenates, cell lysates and other biological fluids. |
Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
SEC310Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenine Phosphoribosyltransferase (APRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-As
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenine Phosphoribosyltransferase (APRT) in Tissue homogenates, cell lysates and other biological fluids. |
Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
4-SEC310Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Adenine Phosphoribosyltransferase elisa. Alternative names of the recognized antigen: AMP
- APRTase
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adenine Phosphoribosyltransferase (APRT) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit |
RDR-UPRT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit |
RDR-UPRT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
RD-APRT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
RD-APRT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit |
RD-UPRT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit |
RD-UPRT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
RDR-APRT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Adenine Phosphoribosyltransferase (APRT) ELISA Kit |
RDR-APRT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit |
SEM983Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uracil Phosphoribosyltransferase (UPRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uracil Phosphoribosyltransferase (UPRT) in Tissue homogenates, cell lysates and other biological fluids. |
Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit |
SEM983Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uracil Phosphoribosyltransferase (UPRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uracil Phosphoribosyltransferase (UPRT) in Tissue homogenates, cell lysates and other biological fluids. |
Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit |
SEM983Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uracil Phosphoribosyltransferase (UPRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uracil Phosphoribosyltransferase (UPRT) in Tissue homogenates, cell lysates and other biological fluids. |
Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit |
SEM983Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Uracil Phosphoribosyltransferase (UPRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Ass
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Uracil Phosphoribosyltransferase (UPRT) in Tissue homogenates, cell lysates and other biological fluids. |
Human Uracil Phosphoribosyltransferase (UPRT) ELISA Kit |
4-SEM983Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Uracil Phosphoribosyltransferase elisa. Alternative names of the recognized antigen: FUR1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Uracil Phosphoribosyltransferase (UPRT) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
APRT ELISA Kit| Bovine Adenine phosphoribosyltransferase ELISA |
EF011086 |
Lifescience Market |
96 Tests |
EUR 689 |
Aprt ELISA Kit| Rat Adenine phosphoribosyltransferase ELISA Kit |
EF018284 |
Lifescience Market |
96 Tests |
EUR 689 |
Qprt sgRNA CRISPR Lentivector set (Mouse) |
K3433801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Qprt ELISA Kit| Rat Nicotinate-nucleotide pyrophosphorylase [ca |
EF019239 |
Lifescience Market |
96 Tests |
EUR 689 |
ELISA kit for Rat Nicotinate-nucleotide pyrophosphorylase (QPRT) |
KTE100365-48T |
Abbkine |
48T |
EUR 332 |
- Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Nicotinate-nucleotide pyrophosphorylase (QPRT) |
KTE100365-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Nicotinate-nucleotide pyrophosphorylase (QPRT) |
KTE100365-96T |
Abbkine |
96T |
EUR 539 |
- Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Nicotinate-nucleotide pyrophosphorylase (QPRT) |
KTE61003-48T |
Abbkine |
48T |
EUR 332 |
- Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Nicotinate-nucleotide pyrophosphorylase (QPRT) |
KTE61003-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Nicotinate-nucleotide pyrophosphorylase (QPRT) |
KTE61003-96T |
Abbkine |
96T |
EUR 539 |
- Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Nicotinate-nucleotide pyrophosphorylase (QPRT) |
KTE10132-48T |
Abbkine |
48T |
EUR 354 |
- Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Nicotinate-nucleotide pyrophosphorylase (QPRT) |
KTE10132-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Nicotinate-nucleotide pyrophosphorylase (QPRT) |
KTE10132-96T |
Abbkine |
96T |
EUR 572 |
- Quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan and acts as a potent endogenous excitotoxin through hyperstimulation of N-methyl D-aspartate (NMDA) receptor in the neuron. Elevation of quinolinate levels in the
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Nicotinate-nucleotide pyrophosphorylase (QPRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Mouse QPRT(Quinolinate Phosphoribosyltransferase) ELISA Kit